Seq ID Score (bits) Sequence
AF007904.1 33.19 .UCUAAC AAAACGGUCCUUAUCAGGACCAAACAUUU
...... .....<<<<<<....>>>>>>..... ...
AY028698.1 32.87 .CAAAAC CCAACGGUCCUUAUCAGGACCACUAUAUA
...... .....<<<<<<....>>>>>>..... ...
AY064471.1 36.81 .GAAcAACC AAACCGGCCCUUUUAAGGGCCACAACcaAUU
........ .....<<<<<<....>>>>>>..... .....
BC016336.1 28.64 .UCU AAAAAGGCCCUUUUUAGGGCCCCUAAGCU
... .....<<<<<<....>>>>>>..... ...
BC020884.1 39.98 .AGACUC CAAAAGGCCCUUUUCAGGGCCCCCAAACU
...... .....<<<<<<....>>>>>>..... ...
J00985.1 35.82 .CCUAUC ACAACGGCCCUUUUAAGGGCCACAAAAAA
...... .....<<<<<<....>>>>>>..... ...
J00986.1 37.43 .UUUccucAUC AAAACGGCCCUUUUAAGGGCCACCAAAAA
.......... .....<<<<<<....>>>>>>..... ...
J00987.1 35.59 .CUUAUA CCCAAGGCUCUUUUCAGAGCCCCCCAcgcUCU
...... .....<<<<<<....>>>>>>..... ......
L19706.1 34.91 .UU UAAAAGGCUCUUUUUAGAGCCACUAAUCU
.. .....<<<<<<....>>>>>>..... ...
L19778.1 36.77 .AGUccAAA CCAACGGCUCUUUUCAGGGCCACCCAcgUCU
........ .....<<<<<<....>>>>>>..... .....
M10557.1 35.30 .GGACAU ACAACGGCCCUUUUCAGGGCCACACAAAU
...... .....<<<<<<....>>>>>>..... ...
M60746.1 38.64 .UUAAAU CCAAAGGCUCUUCUCAGAGCCAACCAcUUU
...... .....<<<<<<....>>>>>>..... ....
M60747.1 33.14 .UU UAAACGGCUCUUUUCAGAGCCACCCAcaGGU
.. .....<<<<<<....>>>>>>..... .....
S49118.1 24.00 .UUAcgC ACCCCGGCUCUUUUCAGAGCCAAAACAUA
...... .....<<<<<<....>>>>>>..... ...
U37575.1 46.04 .UAUAACC CAAACGGCUCUUUUCAGAGCCCCCAAcUUU
....... .....<<<<<<....>>>>>>..... ....
U37576.1 39.38 .UAGcAAC CCAAAGGCUCUUCUCAGAGCCACCCAcUUA
....... .....<<<<<<....>>>>>>..... ....
U62673.1 41.58 .UUUccaCAC AAAAAGGCUCUUUUAAGAGCCACCAAAGU
......... .....<<<<<<....>>>>>>..... ...
V01357.1 37.01 .UGAAACC UCAACGGCCCUUAUCAGGGCCACCAAUUA
....... .....<<<<<<....>>>>>>..... ...
X00224.1 41.91 .UUAUAC CCAAAGGCUCUUUUCAGAGCCCCCCAcACU
...... .....<<<<<<....>>>>>>..... ....
X01685.1 39.76 .GUAAACC AAAACGGCUCUUUUAAGAGCCACCUCcAUU
....... .....<<<<<<....>>>>>>..... ....
X01752.1 39.03 .GAUAU CCAACGGCUCUUUUAAGAGCCACCCAcacUUU
..... .....<<<<<<....>>>>>>..... ......
X02622.1 31.52 .AAAA CCCAAGGCUCUUUUCAGAGCCACCACUUC
.... .....<<<<<<....>>>>>>..... ...
X02624.1 40.71 .UUACCA CAAAAGGCUCUUUUAAGAGCCACCCAccucUUU
...... .....<<<<<<....>>>>>>..... .......
X02916.1 36.54 .AGUAA CCCAAGGCUCUUUUAAGAGCCACCCAACC
..... .....<<<<<<....>>>>>>..... ...
X03017.1 38.77 .CAAcAAC ACAAAGGCUCUUUUAAGAGCCCCCACaUCU
....... .....<<<<<<....>>>>>>..... ....
X03018.1 33.29 .AUUCA ACCAAGGCUCUUUUAAGAGCCACCACACC
..... .....<<<<<<....>>>>>>..... ...
X03952.1 43.63 .AAUAAA CCAACGGCUCUUUUUAGAGCCACCACAUU
...... .....<<<<<<....>>>>>>..... ...
X04384.1 45.00 .AAUAAC CAAACGGCUCUUAUCAGAGCCACCAAAUU
...... .....<<<<<<....>>>>>>..... ...
X04488.1 38.30 .GCUccACC CCAACGGCUCUUAUCAGAGCCACCCAaACU
........ .....<<<<<<....>>>>>>..... ....
X05620.1 40.74 .AUAAUC CAAACGGCUCUUUUCAGAGCCAACACAUU
...... .....<<<<<<....>>>>>>..... ...
X05862.1 37.90 .CGAAUC ACCAAGGCUCUUUUCAGAGCCACUCAcUUU
...... .....<<<<<<....>>>>>>..... ....
X06639.1 40.11 .CAUCAAC AAACCGGCUCUUUUAAGAGCCACCAAAUA
....... .....<<<<<<....>>>>>>..... ...
X06641.1 39.88 .CAACAA ACAACGGCUCUUUUUAGAGCCACCAAAUA
...... .....<<<<<<....>>>>>>..... ...
X06642.1 41.87 .AAUCCA ACAACGGCUCUUUUAAGAGCCACCAAAUU
...... .....<<<<<<....>>>>>>..... ...
X07772.1 37.35 .CAUcAACC AAAACGGCUCUAUUCAGAGCCACCACaAUU
........ .....<<<<<<....>>>>>>..... ....
X13236.1 28.18 .UGUUA CAAAAGGUCCUUUUCAGGACCACUCAcugaAUU
..... .....<<<<<<....>>>>>>..... .......
X13554.1 43.08 .UGGcccccucccccaCUC ACAAAGGCCCUUUUCAGGGCCCCCAAACU
.................. .....<<<<<<....>>>>>>..... ...
X14215.1 34.10 .AUAAUCC AAAACGGCCCUUUUCAGGGCCACAAUGU
....... .....<<<<<<....>>>>>>..... ..
X14730.1 38.23 .AAGcAAC ACAAAGGCUCUUUUUAGAGCCACCCAcUUC
....... .....<<<<<<....>>>>>>..... ....
X15634.1 33.91 .UAAccgAAC CCAACGGCCCUCUUUAGGGCCACAAAUGU
......... .....<<<<<<....>>>>>>..... ...
X16496.1 44.42 .CAAAAC CCAAAGGCUCUUUUCAGAGCCAACCAccUUU
...... .....<<<<<<....>>>>>>..... .....
X17072.1 39.45 .CAAAAG CAAAAGGCCCUUUUCAGGGCCACAAAUCU
...... .....<<<<<<....>>>>>>..... ...
X57128.1 33.62 .UU GAAAAGGCUCUUUUCAGAGCCACUCAcaAUU
.. .....<<<<<<....>>>>>>..... .....
X57130.1 40.07 .AGUAACC CAAACGGCUCUUUUAAGAGCCACCUAcgcAUU
....... .....<<<<<<....>>>>>>..... ......
X58895.1 27.63 .CCUCUU CACACGGCUCUUUUUAGAGCCACAUAcuucUUU
...... .....<<<<<<....>>>>>>..... .......
X60482.1 38.83 .GCAAAA CCAACGGCCCUUUUCAGGGCCACCUAuccACU
...... .....<<<<<<....>>>>>>..... ......
X60483.1 39.71 .UAUCAA CAAAAGGCCCUUUUUAGGGCCCCCACUUU
...... .....<<<<<<....>>>>>>..... ...
X60484.1 34.23 .AA UAAAAGGCCCUUUUCAGGGCCACCCUACU
.. .....<<<<<<....>>>>>>..... ...
X71389.1 33.67 .ACUcccagcAAC ACAAAGGCUCUUCUAAGAGCCCCCAUGUU
............ .....<<<<<<....>>>>>>..... ...
X71390.1 29.26 .ACUcccagcAAC ACAAAGGCUCUUCUAAGAGUCCCCAUGUU
............ .....<<<<<<....>>>>>>..... ...
X72803.1 32.28 .UU UAAAAGGUCCUUUUCAGGACCACAAAaAUU
.. .....<<<<<<....>>>>>>..... ....
X72929.1 42.71 .UAUccccggcccAACC UCAAAGGCUCUUUUCAGAGCCACCACcaACU
................ .....<<<<<<....>>>>>>..... .....
X72950.1 36.24 .CGAcAAC ACAAAGGUUCUUUUCAGAGCCACUAAaucccaAUU
....... .....<<<<<<....>>>>>>..... .........
X80330.1 37.68 .UCUCAA AAAACGGCUCUUUUCAGAGCCACCCAcAGA
...... .....<<<<<<....>>>>>>..... ....
X83548.1 29.94 .GGUUCC UCAAAGGCCCUUCUCAGGGCCACCCAUGA
...... .....<<<<<<....>>>>>>..... ...
X83550.1 39.55 .CAACCC CAAAAGGCUCUUUUCAGAGCCCCUCAAUU
...... .....<<<<<<....>>>>>>..... ...
Y12290.1 46.65 .UAUAAC CCAACGGCUCUUUUCAGAGCCACCAAcAUA
...... .....<<<<<<....>>>>>>..... ....
Y12291.1 41.56 .ACAAUC CAAAAGGCUCUUUUCAGAGCCACCACucccACU
...... .....<<<<<<....>>>>>>..... .......
Z30940.1 36.76 .GCUCCC AAAAAGGCUCUUUUCAGAGCCACCCAcUGA
...... .....<<<<<<....>>>>>>..... ....
Z35401.1 35.92 .CCUccccacaccUCC ACAAAGGCCCUUUUAAGGGCCACCACcucccUCA
............... .....<<<<<<....>>>>>>..... ........
Z38128.1 39.98 .AAAAUCU CAAACGGCUCUUUUCAGAGCCACCCAcaaccucAUU
....... .....<<<<<<....>>>>>>..... ..........
Z46261.1 33.52 .AA GCAAAGGCUCUUUUCAGAGCCACCACcUUU
.. .....<<<<<<....>>>>>>..... ....
Z49861.1 38.72 .GUUcACC CCAAAGGCUCUUUUAAGAGCCACCCACCU
....... .....<<<<<<....>>>>>>..... ...