Seq ID Score (bits) Sequence
AF007904.1 0.00 .CGUCACCUACACCGAGCACGCCAAGAGAAAGACCGUCACCGCCAUGGACGUGGUCUAUGCUCUGAAGCGCCAAGGCCGAACCCUCUACGGAUUCGGCGGUUAGAUUAUGUGCUUAUGAGUACAUCUAAC AAAACGGUCCUUAUCAGGACCAAACAUUUAUUCCAAAGAAUGAUUCAAUCCAAAACCUAUACAUAACUCAAGAAUAUCAGCUUGUGUCUUAGGGUCC
................................................................................................................................. .......................... .......................................................................
AY028698.1 0.00 .UCAAAAC CCAACGGUCCUUAUCAGGACCACUAUAUAUUUUAUUGAUAUUUUUUUCUCUAUGAAGUUGUUUUACAAAUAGAAAUUAAUGUAAGAAUGAAUUGAAAAAAAAAAAA
....... .......................... ................................................................................
AY064471.1 0.00 .ACCGAGCACGCUAAGUGCAAGACCGUCACAGCUAUGGAUGUUGUCUAUGCUCUCAAACGUCAAGGCCGCACUCUCUACGGCUUCGGCGGAUAAGUGCACCCAACCCAAACGUUCAGAACAACC AAACCGGCCCUUUUAAGGGCCACAACCAAUUCCCAAUGGCACUGUCAAAACAGUAAUUGUGUUAUGAGUUGCCCAUACUUCCCAUAGUCCGUGCUCACGCUUG
........................................................................................................................... .......................... .............................................................................
BC016336.1 0.00 .CCCGCGGAGUGUUGAAGGUGUUCCUGGAGAACGUGAUCCGGGACGCCGUGACCUACACGGAGCACGCCAAGCGCAAGACGGUCACCGCCAUGGACGUGGUCUACGCGCUCAAGCGCCAGGGCCGCACCCUCUAUGGCUUCGGCGGCUAAAUGGCAUUUUGAAGCCCAGUCAUUCUCU AAAAAGGCCCUUUUUAGGGCCCCUAAGCUUUCAACAAAAGAGUUGAAAU
................................................................................................................................................................................. .......................... .......................
BC020884.1 0.00 .GUCCCCACAGCUUCUCUACAGACUC CAAAAGGCCCUUUUCAGGGCCCCCAAACUGUCACAGAAAGAGCUGUUAACACUUCCUAGAUAACGGACCAAGUCUAGCUCUGCCACCGAGGCUGGAGUGCAGUGGCACGAUCUCGCCUCCGCCUCCCGGGUUCAAGCGAUUCACCUGCCUCAGCUUCCCGAGUAGCUGGGAUUACAGGCCUGCGCCACCACGCCUGGCUAA
......................... .......................... ...............................................................................................................................................................................
J00985.1 0.00 .UCCUCUUUUCCUAUC ACAACGGCCCUUUUAAGGGCCACAAAAAAAAAAAAAA
............... .......................... ...........
J00986.1 0.00 .GAGCACGCCAAGAGGAAGACCGUCACCGCUAUGGAUGUGGUGUAUGCUCUGAAGCGCCAAGGACGCACUCUGUACGGAUUCGGAGGUUAAAGGCUCGCUUCUGUUUCCUCAUC AAAACGGCCCUUUUAAGGGCCACCAAAAAAAAAAAAAAAAAAAA
................................................................................................................. .......................... ..................
J00987.1 0.00 .GCUGUCACCUACACCGAGCACGCCAAGAGGAAGACCGUUACCGCCAUGGAUGUGGUGUACGCUCUCAAGCGCCAGGGCCGCACUCUCUACGGCUUCGGCGGAUAAAUCUCUUCCUUCCCACUAAUCUUAUA CCCAAGGCUCUUUUCAGAGCCCCCCACGCUCUCACUCCUAGAGCUGUUACUGCUUUUUUUACAUAUUUAU
................................................................................................................................... .......................... ............................................
L19706.1 0.00 .GCGCUUCCAGAGCUCGGCCGUCAUGGCGCUGCAGGAGGCCUGUGAGGCCUACCUUGUGGGUCUGUUUGAGGACACCAACCUAUGCGCCAUCCACGCCAAGCGUGUGACCAUCAUGCCCAAGGACAUCCAGCUGGCCCGCCGCAUUCGUGGCGAGAGGGCUUGAGGAGUUCUGUGAUCCACGCAACCACUU UAAAAGGCUCUUUUUAGAGCCACUAAUCUUCCAAAG
.............................................................................................................................................................................................. .......................... ..........
L19778.1 0.00 .GAGAGCCACCACAAGGCGAAGGGCAAGUAACUAUCUGUACUAGUUUGUGGCAGCUCAAGUAAAAUCGAGUCCAAA CCAACGGCUCUUUUCAGGGCCACCCACGUCUUCUCUAAAAGAACUUAACAUUUAUUCCAUGUGAAAGAAAGUGAGACAUGGACAAGACUCUAGUCAUAAAUUACCCAUCUUUUUGAAAACAGUGUAGCGAACACCGCAGAUUUAAAAGAAA
........................................................................... .......................... .............................................................................................................................
M10557.1 0.00 .CACUACCUCCAAGUAGACAGGUCAUAUCCUGCUCUAAUUGGACAU ACAACGGCCCUUUUCAGGGCCACACAAAUAAUCAAGAAAGAAUGAUAUCCGUAAUA
............................................. .......................... ..............................
M60746.1 0.00 .CUAAAGACAUCCAGCUUGCCCGCCGCAUUCGUGGGGAGAGGGCGUGAAUUGUUUUGAGUACAAACCUUAAAU CCAAAGGCUCUUCUCAGAGCCAACCACUUUGUCCGUGAAAAGGGCUGUAAUCCUUUGAGACGCAUUAGACCACUAAACUGCACUGAUCCAAAUAGACAUUUGAAAUAGUGGCAUUCAGUUCCCUCGAUGCUUCAUUUAAAUUUCCAAAUUUAAG
........................................................................ .......................... ................................................................................................................................
M60747.1 0.00 .GCGGGACGUUCCCCUUUGAAAAUUU UAAACGGCUCUUUUCAGAGCCACCCACAGGUCUCAGUCAAAAGAGCUGAAGCUUUUUGGAGGGGGGAGUGGGGUGGAGAGGGGUGCUGCGGUGUUGUGCGGCCACGGUCUAUCCUAGUCGUGCUGGUUGGGGGUCAGUUAUUAACAGCUCCCAGCAGCCUGGGCGCAAGGAUCC
......................... .......................... ....................................................................................................................................................
S49118.1 0.00 .AAGGUGAAGAAGACCUCGCCCAAGAAAAAGGCUGCACCCAAGAAGAAGUAAAGCCUUUUCCUGACUAUUCAUUCUAGCAUCUGUCUGGACUGUUACGC ACCCCGGCUCUUUUCAGAGCCAAAACAUAUGUUUCAACAGAUAUACAUACCAAGCUCUCUCAAACUCAUUUACAGUCAGCAUUAGAAUGAUUGUACUUCUGAUCACAUCUUUUGUGUCAGGUAGUAGG
.................................................................................................. .......................... ......................................................................................................
U37575.1 0.00 .UCGACCAUCACGUCGCGGGAGAUCCAGACGGCCGUGCGGCUGCUGCUGCCCGGCGAGCUGGCCAAGCACGCGGUCUCCGAGGGCACCAAGGCGGUCACCAAGUACACCAGCUCAAAAUAAGAAGGUUCUAAACUAUAACC CAAACGGCUCUUUUCAGAGCCCCCAACUUUUCUUACAAAGGGCUGUAAUUGCUUUUUUUUUCCCCCCUCAUAUAUAAGAAAAAUUG
............................................................................................................................................ .......................... ............................................................
U37576.1 0.00 .CGCCGUCACCUACACCGAGCACGCCAAGAGGAAGACGGUCACGGCCAUGGACGUGGUCUACGCGCUCAAGCGCCAGGAACGCACCCUCUACGGCUUCGGCGGUUAAACUCGCCUUCGAUAACAGCUCGUUUUUAGCAAC CCAAAGGCUCUUCUCAGAGCCACCCACUUAAAUUGGAAAAGAGCUGUGUCGCUUCAACCUAGUUAAGUCUUAAUUCUAGCACCAGUA
........................................................................................................................................... .......................... .............................................................
U62673.1 0.00 .AACAAGUUACUAGGGGGAGUCACCAUCGCCCAGGGCGGGGUCCUCCCCAAUAUUCAGGCUGUCUUACUUCCGAAGAAAACGGAAAGUCAUAAGCCUGGAAAGAACAAAUAACUAUUAUCCCUUUCCACAC AAAAAGGCUCUUUUAAGAGCCACCAAAGUGUCAUCCAAAGGGCUGGUCACAAACUGGCGCGUUAGCUAGCUCCUUUGUAAAAGAUUUGGUGGCUCU
.................................................................................................................................. .......................... ......................................................................
V01357.1 0.00 .ACGAUCGCUCAAGGUGGUGUUCUGCCCAACAUCCAAGCCGUGCUGCUCCCCAAGAAAACCGCUAAAUCAAGCUAGAUAGAGUUUGCUCCCGGCAAUCUUGAAACC UCAACGGCCCUUAUCAGGGCCACCAAUUACUCACGAAAGAAUUGUUUCAUUUAUGAAUUCCCUUCCCCCACUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCUC
......................................................................................................... .......................... ...............................................................................................
X00224.1 0.00 .GAGAAUGUCAUCCGGGACGCUGUCACCUACACCGAGCACGCCAAGAGGAAGACCGUUACCGCCAUGGAUGUGGUGUACGCUCUCAAGCGCCAGGGCCGCACUCUCUACGGCUUCGGCGGAUAAAUCUCUUCCUUCCCACUAAUCUUAUAC CCAAAGGCUCUUUUCAGAGCCCCCCACACUCUCACUCCUAGAGCUGUUACUGCUUUUUUUACAUAUUUA
...................................................................................................................................................... .......................... ...........................................
X01685.1 0.00 .UGAGGACACCAACCUGUGCGCCAUCCACGCCAAGCGUGUCACCAUCAUGCCCAAGGACAUCCAGCUGGCCCGCCGUAUCCGCGGCGAGCGGGCUUAAUAGGCACGCUUUCUACACUGGCACGUAAACC AAAACGGCUCUUUUAAGAGCCACCUCCAUUAUCCACCAAAGAUGCUUGAAGUACAAGUUGUGAGAGUUUUCUAGGGUUUCCUAUUAUAGCCUUUCUUG
................................................................................................................................ .......................... ........................................................................
X01752.1 0.00 .GCCAAGGCUGGCCGCCCCAAGAAGGCCGCCAAGAGCCCGGCCAAGGCAAAGGCGGUGAAGCCCAAGGCUGCCAAGCCCAAGGCGACCAAACCCAAGGCGGCCAAGGCGAAGAAGACGGCAGCCAAGAAGAAGUAAGUUAUCCCAGAAGAGUCCUGCUCUACCUAUUUUGAUAU CCAACGGCUCUUUUAAGAGCCACCCACACUUUCCCUAAAGGAGCUGAGGCACC
............................................................................................................................................................................. .......................... ...........................
X02622.1 0.00 .AAAA CCCAAGGCUCUUUUCAGAGCCACCACUUCUUCAUAUAAGAG
.... .......................... ...............
X02624.1 0.00 .UACCAAGGCAGCGAAGCCCAAAGCCGCCAAGCCCAAGGCGGCCAAGGCCAAGAAGGCAGCCCCCAAGAAGAAGUAAACCUAUUACAAACAGUGUUCUUUCUACUCGACACAUGUUGUUACCA CAAAAGGCUCUUUUAAGAGCCACCCACCUCUUUCCAUAAAAGCGCAUGUCAUUCCAUUCCACCUACCUACCCGUGGUGCAAAAGAAAUGAAAUGAAUGACUUUU
.......................................................................................................................... .......................... ..............................................................................
X02916.1 0.00 .UUCGAGCGUAUCGCCGGAGAGUCGUCUCGCUUGGCCCACUACAACAAGCGUUCCACCAUCACCUCUAGGGAGAUCCAGACCGCAGUGCGCCUGCUGCUCCCCGGAGAGCUGGCCAAGCACGCAGUGUCCGAGGGCACCAAGGCCGUGACCAAGUACACCAGCUCCAAGUAAACAGCCCAUUUGGAGUGCUGUAGUAA CCCAAGGCUCUUUUAAGAGCCACCCAACC
..................................................................................................................................................................................................... .......................... ...
X03017.1 0.00 .CCAACAAC ACAAAGGCUCUUUUAAGAGCCCCCACAUCUUAUUUUAGGAAGAUCUGUAACUUCUCUGAGGCGUGCUAAUGAAAAGUAAUAUUUUAGGGCUUCAUAUUCUAUAGUGUGUCUGUCUCUUCUCGGACUUUACAAGAAAAUGCUUUUGGCGUUCGUGACAUCCCUAACUUUCUAUAAAUACUUGAGCUUUAACCUCGCUGUGUGAGUCCCUGGUUCUACAG
........ .......................... ................................................................................................................................................................................................
X03018.1 0.00 .CCAAUUCA ACCAAGGCUCUUUUAAGAGCCACCACACCCCCCUGAAAGAGCUUACAACUUCCCGCGUCUCCUGCUUCUACCACAAGUCUCCCUACAUACCGUAAUAUUUUCUCACUAACACCACUACAAGUUCCCACAUGUAGUCGUUUAGUGGUGCCGGCCGCCGCGAGUACCAACUCGGCUUAAACAUUCUAUUCGGAGGGAGGAGGGCGGAGAGAGUUAAUGGA
........ .......................... ................................................................................................................................................................................................
X03952.1 0.00 .ACAUCUAAAUAAA CCAACGGCUCUUUUUAGAGCCACCACAUUUCCAAGAAAGAUCAAAUUCUAAACUCUGCGUAGAUC
............. .......................... .......................................
X04384.1 0.00 .CACCAUCUCCAGCCGGGAGAUCCAGACUGCUGUUCGUCUACUUCUCCCAGGAGAACUGGCCAAGCAUGCUGUAUCCGAGGGAACGAAGGCUGUGACCAAAUAUACCACCUCCCGCUAAAUUUCACCAGCUUUCGUUUAGCUGGAAAAUAAC CAAACGGCUCUUAUCAGAGCCACCAAAUUUUCAAGAAAGAAUCGAAAAUACAUCUCUUUUUGCCCAACACGUAGC
....................................................................................................................................................... .......................... .................................................
X04488.1 0.00 .CCAAGCCAGCAAAGAAGGCAGCCAAGAAGCCCGCCGCCAAGAAGGCAGCCAAGAAGUAAAUUCUUAGCGCCACUUGGUGUAUUGAGCUUUUUCAGCUCCACC CCAACGGCUCUUAUCAGAGCCACCCAAACUUCAAGAAAGAAUUC
...................................................................................................... .......................... ..................
X05620.1 0.00 .AAGGCGGUCACCAAGUACACGACUUCAAAAUAAGCUGGCCCGAGGUCAUGCAUAAUC CAAACGGCUCUUUUCAGAGCCAACACAUUUCCCAAAGAGAGAUUUAAACAUG
......................................................... .......................... ..........................
X05862.1 0.00 .GAAGUGAAACCAAACAUUACGAAUC ACCAAGGCUCUUUUCAGAGCCACUCACUUUCUCAAAGAGACCUAACACUACUGGGAUAGUGCAUUGUGGGAAAUACGUGUAUUAACCUUCCUCCUAUUUUCCCUGCUUGUGGUUAGUUCAACCCCUAAGCCUUAGGCUAAGAGUAUAUUGGUUUUUGGAAGGCAGGCACCCAACCUCGGACCUAGUACAUAAAACAGACAC
......................... .......................... ...............................................................................................................................................................................
X06639.1 0.00 .CCUUGAGAACGUCAUCCGUGAUGCCGUCACCUACUGCGAGCACGCCAAGAGGAAGACCGUCACCGCCAUGGACGUCGUCUACGCCCUGAAGCGACAGGGACGUACCCUCUACGGAUUCGGAGGUUAAGAAGUUACUCUCUUCCAACCCAUCAAC AAACCGGCUCUUUUAAGAGCCACCAAAUAACCAAGAAAGAAUACAGUAGAUAUCUUUGUACGUUUUUUUUUU
.......................................................................................................................................................... .......................... ..............................................
X06641.1 0.00 .AUGGACGUCGUCUACGCCCUGAAGCGACAGGGACGUACCCUCUACGGAUUCGGAGGAUAAGAAGUGACUUUCUUACAAGCAACAA ACAACGGCUCUUUUUAGAGCCACCAAAUAUUCAAGAAAGAAAUAUUAGAUAAACUUGUUUAAGUCUUAUUAAUAUUGAUACAUGUAAUGAAAUAUGAAAUUUAAUAUCAGUAAAUAAUUAAUUGGAAUUAGCCGAGUC
..................................................................................... .......................... ................................................................................................................
X06642.1 0.00 .GAACAAGCUGCUCAGUGGAGUCACCAUCGCCCAAGGUGGUGUCCUCCCCAACAUCCAGGCCGUACUUCUGCCCAAGAAGACCUCCAAGGCCUCCAAGUAAACGGGCCNNNNNNCCUCUUCGGAGCAAUCCA ACAACGGCUCUUUUAAGAGCCACCAAAUUUCCAAGAAAGAAACAGCAGAUGCACUCUAAUUAUGUUUAAAUAUUUUAAUGGUACUUUAAGUUACU
................................................................................................................................... .......................... .....................................................................
X07772.1 0.00 .UAGACAGAAAUCCAAGCAUCAACC AAAACGGCUCUAUUCAGAGCCACCACAAUUUCACAAAAGAGAUCAAUUCCUAUCAAGUACCGUUUGCUCCUACGAACUGGACUCAUUAUUACAAACUCAAACACUUUUUUUACAAACUCAAACACUUUUUUUACAAACUCAAACACUUUUUU
........................ .......................... ..............................................................................................................................
X13236.1 0.00 .CACGGAGCACGCCAAGCGCAAGACCGUCACCGCCAUGGACGUGGUCUACCGGCUCAARCGCCAGGGCCGCACCCUCUACGGAUUCGGGGGUUAAGGGACUAGAGCGAUUUUCUUAACUGUUA CAAAAGGUCCUUUUCAGGACCACUCACUGAAUUCCUUAAAAAGCUGUGCAUUUUGCUCCCUCACCCUUCCCCCACACUGGCAGCCGCCCUCACUAAUAGCUUCA
.......................................................................................................................... .......................... ..............................................................................
X13554.1 0.00 .CCUUGGCCCCCUCCCCCACUC ACAAAGGCCCUUUUCAGGGCCCCCAAACUAUCCAAAAGGAGCUGUGGACAUUUAGUCUCUAGGUUAGGAUUUAUGAACACCCAAUCCUUAGCAUUCGGCUUAGCAUUGUCUCGUAUGCAAACUAAGCUU
..................... .......................... .......................................................................................................
X14215.1 0.00 .CCAAACGGCUGUUCGCCUGCUUUUGCCUGGAGAGUUGGCCAAGCAUGCUGUCAGUGAGGGAACCAAGGCUGUCACCAAGUACACCAGCUCUAAAUAAUUUUCUCCUGCGAAUGCGGACAAUAAUCC AAAACGGCCCUUUUCAGGGCCACAAUGUGUUAUACCAAAGAAAUGCAUUUUUCAACCACCAAUCAUCGAAUAUGAAUUUACAAAUAAAACUUAUUUACCC
.............................................................................................................................. .......................... ..........................................................................
X14730.1 0.00 .AGACGCGCAUCAUCCCCCGCCACCUGCAGCUGGCCAUCCGCAACGACGAGGAGCUCAACAAGCUGCUGGGCAAGGUCACCAUCGCGCAGGGCGGGGUGCUGCCCAACAUCCAGGCCGUGCUGCUGCCCAAGAAAACCGACAGCCACAAGGCUAAAAGCAAGUAAAAACCCGGGGACUGUUCCCACCUCAAGCAAC ACAAAGGCUCUUUUUAGAGCCACCCACUUCC
................................................................................................................................................................................................... .......................... .....
X15634.1 0.00 .UCUAACCGAAC CCAACGGCCCUCUUUAGGGCCACAAAUGUAAUAUAAUCCGGCUUGAUUUCUAAUAAAUUUGUAUUGUU
........... .......................... ..........................................
X16496.1 0.00 .CCCAAGGACAUCCAGCUUGCUCGCCGCAUUCGUGGGGAGAGGGCGUAAAUUGUCUUGUGAAUGUGUGCUAACCAAAAC CCAAAGGCUCUUUUCAGAGCCAACCACCUUUUCUAUAAAAAGUUGCGU
.............................................................................. .......................... ......................
X17072.1 0.00 .CUCUCGUUUGGCCCACUACAACAAACGUUCUACGAUUACCAGUCGGGAAAUCCAAACUGCAGUCCGUCUUCUGUUGCCCGGAGAGUUGGCCAAGCACGCUGUCAGUGAAGGAACAAAGGCAGUUACCAAGUACACUAGCUCCAAGUAAAUCUUAGCUUGAUGUAUGCAGAACACCCAAAAG CAAAAGGCCCUUUUCAGGGCCACAAAUCUUUUUUCAAAGAAUAUG
..................................................................................................................................................................................... .......................... ...................
X57128.1 0.00 .CUAUUCACGCUAAACGCGUCACCAUCAUGCCCAAAGAUAUCCAGCUGGCACGUCGCAUCCGUGGGGAAAGGGCAUAAGUCUGCCCGUUUCUUCCUCAUU GAAAAGGCUCUUUUCAGAGCCACUCACAAUUUCACUUAAAAACAGUUGUAACCCAUUCGGUUGUCUAUGUUAGUUUCCAGGAGAUAUAAACGUGAUAACUACACACAAGUUUUGUAACUGCAGACAA
................................................................................................... .......................... .....................................................................................................
X57130.1 0.00 .UAGUAACC CAAACGGCUCUUUUAAGAGCCACCUACGCAUUUCAGGAAAAGAGCUGUAGUACACAGAUGAAAUCCCCCAAGCAAAUGCAACACGCCCUCAAUUAUAUUAGAAUCACUUGGAGAGUCGAUAGAACUUUAACAUAGCCUCAUCUAGUAAGAAUUUACUACUCAAUCUAUCAAAGAUAGCAAGGAUUGAAUUC
........ .......................... .....................................................................................................................................................................
X58895.1 0.00 .CCAUCCACGCCAAGCGUGUCACCAUCAUGCCCAAGGACAUCCAGCUGGCCAGACGUAUCCGUGGCGAGCGUGCUUAAACAGCAGCGACCCACAUAGCUGUACCUCUU CACACGGCUCUUUUUAGAGCCACAUACUUCUUUUUAGAAGAUGCUUAACGUGCUUGUCGAGAUAGCAGUUGACUGUAAUAGUUGCACUUUAUUAGCACAUAAACAAAGCAUUAUGCCCU
........................................................................................................... .......................... .............................................................................................
X60482.1 0.00 .CGGAGUGCUGAAAGUUUUCCUGGAAAAUGUAAUCCGCGAUGCUGUCACCUACACGGAACACGCCAAACGCAAGACAGUCACAGCCAUGGACGUGGUGUACGCGCUCAAGCGCCAGGGACGCACUCUUUAUGGCUUCGGCGGCUGAGCUUACCUCUACAGUACACUACCGCAAAA CCAACGGCCCUUUUCAGGGCCACCUAUCCACUCAGGAGAAAGAGUAGUAGUC
.............................................................................................................................................................................. .......................... ..........................
X60483.1 0.00 .GGCCGCACCCUCUACGGUUUCGGUGGUUGAGCGUCCCUUUCUAUCAA CAAAAGGCCCUUUUUAGGGCCCCCACUUUCUCAGCUGAGGAGCCGUGAUGCUUGUUUGCCCAGUUUCUCUUUACCAUUUGUUCGCGCCUCCUGAGUUUGUGCUGCUAUCGGAGCAUGCGUCUCUAGUCGCUGUAAGUAGGCAUCAGUCACUAAUCGCUCUCCAGUAAAUAAAAUACCCA
............................................... .......................... .........................................................................................................................................................
X60484.1 0.00 .CCAGGGCCGCACCCUCUACGGUUUCGGUGGUUGAGCGUCCUUUUCUACCAA UAAAAGGCCCUUUUCAGGGCCACCCUACUUUCUCAGCUGAAGAGUGGUAACACUGAGGAGUGGUUUUGGUAGGUACGGAAUUUUGCUUGGUUCUGAGUCAGUUCUGGGGGGAACAGUUUUUUGAACACAGCGGCACACGUGUGGCCAUUCACCCGGGGUCACUGUAGGCAGGACU
................................................... .......................... .....................................................................................................................................................
X71389.1 0.00 .AAGUAACUGCUCCUUGUCCUGCUCUACUCCCAGCAAC ACAAAGGCUCUUCUAAGAGCCCCCAUGUUCUCUCUACAAGAACUGCAACUCCCUGUAAG
..................................... .......................... .................................
X71390.1 0.00 .CUGCCUGGGGAGUUGGCUAAACACGCCGUGUCCGAGGGCACCAAGGCUGUGACCAAAUACACCAGCGCCAAGUAAUUGUUCCUUGUCCUGCUCUACUCCCAGCAAC ACAAAGGCUCUUCUAAGAGUCCCCAUGUUUUUUCUAUAAGAAUGGCAAUUCCCCGCAAG
.......................................................................................................... .......................... .................................
X72803.1 0.00 .GUU UAAAAGGUCCUUUUCAGGACCACAAAAAUUAUUUUAAUUGAAGAAAAGUUUUUGAUUUUUUUGGUAUUUUAAUUUAUUUAAUAUAUUUUUGUGUACACUCAAGAUACACAAGAUGCUCAGAUUGCAUCUCUAAAAUCCAUUUCAAGGCCCAUUAAAGUCACACCCUAUCCAAAGAUCUUCUUCCAAAAUCCAGGCUUUACAGUUGUUGUAUCUUCUGAAGCAU
... .......................... .....................................................................................................................................................................................................
X72929.1 0.00 .GGGGAAGAAGGCUGCGGCUAAAAAGUAACUUGGUUCGGUGUCCCUGACUAUCCCCGGCCCAACC UCAAAGGCUCUUUUCAGAGCCACCACCAACUCCGUCAGAAGAGCCGAUACUGUGACUGCUCAUUAUGUCAGGGAGGCUUUCUGGUAUCUGCUGAAUUGUGCGAUGCCCAGUCUGAUCUUUCAGCCCCAUCUCCCCUUAACUGCGUCUCCCACACAAGUCACU
................................................................ .......................... ........................................................................................................................................
X72950.1 0.00 .GCCCGCAGGAUCCGAGGCGAGAGGGCUUAGAUACAGCUGCCACUUCUCAUACGACAAC ACAAAGGUUCUUUUCAGAGCCACUAAAUCCCAAUUACUUGAGCUGAACGCCAGUUAUUUCCUUUUUAUUCAGGGCGGGAAUCCGGAGAGAUCUUUGUCUGAUAAAAACUAUAUCGGUUCUACACAACAGGGAGUAAUGGGCACGUGACUCUUUACUCUGGUACCGAUG
.......................................................... .......................... ..............................................................................................................................................
X80330.1 0.00 .AAGGGCAAGUGAGGCGGCUGCUGGCACCGGCCCGCGUCUCUACGAACCCUUCCCCCCCCCCCAGAGAACUCUCAA AAAACGGCUCUUUUCAGAGCCACCCACAGAAUCAGAUAAAGAGUUGUGUCACGGUAACCCGUCUCUUGGCCUUUCCCGGCCCUUCCCCAACAGUAAGAAUGUCGUGUGCCCUACUCUUCCCCUGGGUCCCUCUGGUAGUGCCUGUUGCUGU
........................................................................... .......................... .............................................................................................................................
X83548.1 0.00 .ACGCAAGACAGUCACAGCCAUGGACGUGGUUUACGCGCUCAAGCGCCAGGGCCGCACCCUGUAUGGCUUUGGCGGCUGAGUGUUUUACUUACUUACACGGUUCC UCAAAGGCCCUUCUCAGGGCCACCCAUGAAGUCUGUGAAAGAGCUGUAGACUAAAGAUAGUUAAUUUCUUAAGAACACUUAAACGUAUGGCAGUUUUGGCAAAUUAGCGAUUCCACAUAAGC
........................................................................................................ .......................... ................................................................................................
X83550.1 0.00 .GAGGCUUGCGAGGCCUACCUGGUGGGGCUAUUUGAGGAUACCAACCUGUGCGCCAUUCACGCCAAACGCGUCACUAUUAUGCCUAAAGACAUCCAGCUUGCGCGCCGCAUCCGAGGGGAGAGGGCAUAAAUAUUCCUAUCAGCCCAAGAAGUCUGUCCAACCC CAAAAGGCUCUUUUCAGAGCCCCUCAAUUGUCACCAAAAGGAAGCUGUAGCUUUUGAGACGUG
................................................................................................................................................................... .......................... .....................................
Y12290.1 0.00 .GGCAGCGCCCAAGAAAAAGUGAACAGUUGGAGGCUUCUUCUAUAAC CCAACGGCUCUUUUCAGAGCCACCAACAUAACUCAAAGAGCCUGACACUUGUUUCACACUAUAACAACUGCAUUUGGGUACAAGCCUGGUGGGAUUUAGGCAUUAUUAAUUUCCCCCAGUAAACUGACAAUUUGGGUCAGUCUAGUUUCUAGUUUUAUUUCCCUGAGAUUCUGGGAAAAC
.............................................. .......................... ..........................................................................................................................................................
Y12291.1 0.00 .AAGCCGUAAAGCCAAAGGCUGCCAAGCCCAAGGUUGCCAAGGCCAAGAAGGUUGCAGCCAAGAAAAAGUAGGCUGCCUCCCCUAACAAUC CAAAAGGCUCUUUUCAGAGCCACCACUCCCACUUAAGAGCUGUGACAUUUGUGUGAUUAAUGAAGCAAGGUUGCAAGGGACUCGAUCCCGGCAGCACUCGCUCCCCCGGUGGGAUGGGUGGGGUUGCGUGUCCCAC
.......................................................................................... .......................... ..............................................................................................................
Z30940.1 0.00 .CAAGUGAGGCCACUGCUCGCGUCGGCCCGCGUCUCUGUGAUAUAACCCCCGCGAGCUCCC AAAAAGGCUCUUUUCAGAGCCACCCACUGAAUCAGAUAAAGAGUUGUGUCACGGU
............................................................ .......................... .............................
Z35401.1 0.00 .CGAGGCCGCCCAGCCCUCCCCACACCUCC ACAAAGGCCCUUUUAAGGGCCACCACCUCCCUCACAGAAAGAGCUGAGCCACUUCGGGCUGCGGCGGCUUGCCGCGUCCCCAUCCUUUCUCUUUCCCUCCUCUCCCCUCCCCGCCCUCGCGCCACUCUUCCCCUUACCCCGCACGGCCUCCGGUUCUGCCACGGAGGACGCGGGCGCCGCGGCACCUGCCCAUCCCG
............................. .......................... ...........................................................................................................................................................................
Z38128.1 0.00 .GGCUCCCAAGGCUAAGGCUUCCAAGCCUAAAGCUUCUAAGCCGAAGGCCACCAAGGCAAAGAAGGCUGCCCCUCGCAAGAAGUAGAGUGGUGCGUCCUGCUUUGAAAAUCU CAAACGGCUCUUUUCAGAGCCACCCACAACCUCAUUCAAAAGAGCUGAGCCUUUUUCUGGUUUUCUCAUGGUAUGUCCGCUGACUCUGGCUAUGUGUUCCGAAGCAGAUCAAUUC
............................................................................................................... .......................... .........................................................................................
Z46261.1 0.00 .CAA GCAAAGGCUCUUUUCAGAGCCACCACCUUUUCAAGUAAAGUAGCUGUAAGAAACCAAUUUAAGACAAAAGGGAAUGCAUUGGGAGCACUUUUCGUUUUAAUGCUACUGAAGGCUUCAAAACCAAUCGAUUUCGGCCGGUCGCGGAGACUCACGCCUGUAAUUCAAGCACUUUAAGAGGCUGAGGCGGGCGGAUUACCAGAAAUCAGGAGUUCGGGAUCAGCCU
... .......................... .....................................................................................................................................................................................................
Z49861.1 0.00 .GAGGCGUGCGAGUCUUACCUGGUGGGGCUGUUUGAGGACACCAACCUGUGUGUCAUCCAUGCCAAACGGGUCACCAUCAUGCCUAAGGACAUCCAGCUGGCACGCCGUAUCCGCGGGGAGCGGGCCUAGGAGGGCUAUCUCGCCACCUGAGAGGUUGCGCAACGUUCACC CCAAAGGCUCUUUUAAGAGCCACCCACCUGGUCGAAGAGUUGCUGUAGCAAGCUAG
.......................................................................................................................................................................... .......................... ..............................