Seq ID Score (bits) Sequence
AF029859.2 0.00 .AGAGCACAAUUAGUAGAUUAAAU UGGCUUAACCCUACCGCAUGAACCGAACUUGAU.....AAAAGUGCGGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
.....<<........<<.....> >.......<<<<<<<<<<.........................>>>>>>>>>>>>.......<<<<<..<...>>>>>>
AF083069.1 0.00 .AGAACACUCAAGAUCAUGUGCGCUCACUGUGUCUAUUGGCCUGGCACAACGGAGAGCACGAAUAUGAGGAGUUCAUCCGUAAAAUUAGAAGCGUCCCAGUCGGACGUUGCUUGACCCUCCCUGCGUUUUCAACCCUGCGCAGGAAAUGGUUGGACUCUUUCUGAAUUAGAGACAAUUUGAAAUAAUUUGAAU UGGCUUAACCCUACUGUACUAACCGAACUAGAU.....AACGGUGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
............................................................................................................................................................<.<<...>>...>..<<..........<<......> >.......<<<<<<<<<<.........................>>>>>>>>>>>>.......<<<<<..<...>>>>>>
AF085363.1 0.00 .AUUGGCCUGGCACAAUGGAGAGCACGAGUAUGAGGAGUUCAUCCGCAAAAUCAGGAGCGUCCCGGUCGGACGUUGCUUGUCUCUGCCUGCGUUUUCGACCUUGCGCAGGAAGUGGUUGGACUCUUUUUAAAUUAGAGACAAUUUGAACUAAUUUGAGU UGGCUUAACCCUACUGCAUCAACCGAACUAGAC.....AACGGUGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGGAGGAG
..........................................................................................................................<.<<...>>...>..<<..........<<......> >.......<<<<<<<<<<.........................>>>>>>>>>>>>.......<<<<<..<...>>>>>> .....
AF114383.1 0.00 .CUUUCUAAAUUGGAGACAAUUUGAGAUAAUUUGAAU UGGCUUAACCCUACCGCACUAACCGAACUAGAU.....AACGGUGCGGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
..<<...>>...>..<<..........<<......> >.......<<<<<<<<<<.........................>>>>>>>>>>>>.......<<<<<..<...>>>>>>
AF114384.1 0.00 .AUUCAUUCGAAAGGUCAGAAGCGUUCCUGUUGGACGCUGUUUGACUCUACCUGCGUUCUCGACACUACGCAGAAAGUGGUUGGAUUCCUUCUAAAUUAGAGACAAUUCGAUAAAAUUUGAAU UGGCUUAACCCUACUGCGCUAACCGAACUAGAC.....AACGGCGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
......................................................................................<.<<...>>...>..<<..........<<......> >.......<<<<<<<<<<.........................>>>>>>>>>>>>.......<<<<<..<...>>>>>>
AF162711.1 0.00 .UGGCUAGACUCUUUUUAGAUUAGAGUACAAUUAUAUAAUUUUAAUUUUAAU UGGCUUAACCCUACCACACUUACCGAACUAGAC.....AACGGUGUGGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
..........<.<<...>>...>...<<..............<<......> >.......<<<<<<<<<<.........................>>>>>>>>>>>>.......<<<<<..<...>>>>>>
AF230973.1 0.00 .UCAUCCAGACAGAUCAGAUAGCAUCCCAGUUGGGCGCUGUUUGACUUUACCUGCGUUUUCAACCCUGCGCAGGAAAUGGUUGGACUCUUUUUAGAUUAGAGACAAUUUGAAUAAUUUAAAU UGGCUUAACCCUACUGCAUUAACCGAACUAGAC.....AACAAUGCAGUAGGGGUAAAUUUUCCGCG..UUCGGUGCGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
......................................................................................<.<<...>>...>..<<.........<<......> >.......<<<<<<<<<<.........................>>>>>>>>>>>>.......<<<<<..<...>>>>>> ..................................................
AF241359.1 0.00 .CUCUUUUUAAAUUAGAGACAAUUUGAAAUAAUUUGAAU UGGCUUAACCCUACUGUACUAACCGAACUAGAU.....AACGGUACAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
..<.<<...>>...>..<<..........<<......> >.......<<<<<<<<<<.........................>>>>>>>>>>>>.......<<<<<..<...>>>>>>
AF268065.1 0.00 .CAAUUAAUCAAUUACAAU UGGCUCAACCCUACCGCAUGAACCGAACUU-AC.....AAAAGUGCGGCAGGGGUAAAUUUUCCGUG..UUCGGUGCGGAAAAAA
.........<<......> >.......<<<<.<<<<<.........................>>>>>.>>>>>........<<<<<..<...>>>>>> ......
AF317694.1 0.00 .CCAGUAGGGCGAUGUUUGACUCUACCUGCGUUCUCAACCCUACGCAGGAAGUGGUUGGACUCCUUCUAAAGUAGAGACAAUUUGAUCUAAUUUGAAU UGGCUUAACCCUACUGCACUAACCGAACUAGAU.....AACGGUGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
.............................................................<.<<...>>...>..<<..........<<......> >.......<<<<<<<<<<.........................>>>>>>>>>>>>.......<<<<<..<...>>>>>>
AF405682.1 0.00 .UCACUGUGCCUAUUGGCAUGGCACAAUGGCGAAGAAGAAUACAAUAAAUUCUUAGCUAAAAUAAGAAGUGUGCCAAUCGGAAGAGCAUUGUUGCUCCCUGAGUACUCAACCUUGUACCGCCGUUGGCUCGACUCAUUU --UAGUAACCCUACCUCAGU---CGAAUUGGAUuggguCAUACUGUUGUAGGGGUAAAUUUUUCUUUaaUUCGGAG---A
............................................................................................<.<<...>>...>...<<..............<<......>>.... __......<<<<<<..<<.........................>>..>>>>>>>>.......<<<...>...>>..... .
AF405690.1 0.00 .AUCAGAUGGACUAAGGAUCCUAGGAACACCCAGGAUCAUGUUCGCUCACUGUGCCUAUUGGCCUGGCACAAUGGCGAAGAAGAAUACAACAAAUUUUUAGCUAAAAUCAGAAGCGUGCCAAUCGGCAGAGCUUUACUGCUCCCCGAAUACUCUACGCUGUACCGCCGUUGGCUCGACUCAUUU --UAGUAACCCUACCUCAGU---CGAAUUGGAUuggguCAUACUGUUGUAGGGGUAAAUUUUUCUUUgaUUCGGAG---A
.........................................................................................................................................<.<<...>>...>...<<..............<<......>>.... __......<<<<<<..<<.........................>>..>>>>>>>>.......<<<...>...>>..... .
AJ132961.1 0.00 .AACAAAUUUUUAGCUAAAAUUAGGAGUGUGCCAAUUGGAAGGGCUUUAUUGCUCCCAGAGUACUCAACGUUGUAUCGUCGUUGGCUUGACUCAUUU --UAGUAACCCUACCUCAGU---CGAAUUGGAUuggguCAUACUGAUGUAGGGGUAAAUUUUUCUUUaaUUCGGGG---
..................................................<.<<...>>...>...<<..............<<......>>.... __......<<<<<<.<<<.........................>>>.>>>>>>>>.......<<<...>...>>.....
AJ245864.1 0.00 .GCUUGGCUCUUCCUGCGUUCUCAACACUGCGCAGGAAGUGGUUGGACUCCUUCUAGAAGUAGAGCACAAUUUGUAAAUUACAAU UGGCUCAACCCUACCGCAUGAACCGAACUUGAC.....AAAAGUGCAGUAGGGGUAAAUUCUCCCGA..UUCGGUGCGGAGGAGAAAA
................................................<.<<....>>...>...<<........<<......> >.......<<<<<<.<<<.........................>>>.>>>>>>>>.......<<..<..<...>>..>> .........
AJ276224.1 0.00 .AAUACCCAGGACCAUGUUCGAUCCUUGUGCCUAUUGGCCUGGCACAAUGGCGAGCAAGAAUACGAAGAAUUUGUGUCCAAAAUCAGGAGCGUUCCAGUAGGGCGCUGUUUGACUUUGCCUGCAUUCUCAACUCUACGCAGGAAAUGGCUGGAUUCUUUUUAAAUUAGAGUACAAUUUGGUUAAAUUCCAAU UGGCUUAACCCUACCACACUCACCGAACUAGAU.....AACGGUGUGGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
..........................................................................................................................................................<.<<...>>...>...<<..........<<......> >.......<<<<<<<<<<.........................>>>>>>>>>>>>.......<<<<<..<...>>>>>>
AY036578.1 0.00 .GUGGUUGGAUUCCUUUUGAACUAGAGACAAUUUGAUACAAUUUGAAU UGGCUUAACCCUACUACACUUACCGAACUAGAC.....AGCGGUGUAGUGGGGGUAAAUUCUCCGCA..UUCGGUGCGG
...........<.<<...>>...>..<<..........<<......> >.......<<<<<<<<<<.........................>>>>>>>>>>>>.......<<<<<..<...>>>>>>
AY036579.1 0.00 .UGAAU UGGCUUAACCCUACUGCACUAACCGAACUAGAU.....AACGGCGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
..... ........<<<<<<<<<...........................>>>>>>>>>.........<<<<<..<...>>>>>>
D00625.1 0.00 .CAAUAAAUUUUUAGCUAAGAUUAGAAGUGUGCCAAUCGGAAGAGCUUUACUGCUCCCUGAGUACUCCACAUUGUACCGCCGUUGGCUCGACUCAUUU --UAGUAACCCUACCUCAGU---CGAAUUGGAUuggguCAUACUGUUGUAGGGGUAAAUUUUUCUUUaaUUCGGAG--G
...................................................<.<<...>>...>...<<..............<<......>>.... __......<<<<<<..<<.........................>>..>>>>>>>>.......<<<...>...>>.....
D00627.1 0.00 .CCAAAGAACACCCAAGACCACGUGCGCUCGCUAUGCUUAUUAGCUUGGCACAACGGGGAGCACGAAUAUGAGGAGUUCAUUCGCAAAAUCAGGAGCGUCCCAGUUGGACGUUGUUUGACCCUACCUGCGUUCUCAACCCUACGCAGGAAGUGGUUGGACUCUUUCUAAAUUAGAGACAAUUUGAACUGAUUUGAAU UGGCUCAACCCUACUGUACUAACCGAACUAGAU.....AACGGUGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGGAGG
................................................................................................................................................................<.<<...>>...>..<<..........<<......> >.......<<<<<<<<<<.........................>>>>>>>>>>>>.......<<<<<..<...>>>>>> ...
D10582.1 0.00 .CCGGUCGGACGUUGCUUGACUCUGCCCGCAUUUUCAACCUUGCGUAGGAAGUGGUUGGACUCUUUUUAAACUAGAGACAAUUUGAACUAAUUUGAAU UGGCUUAACCCUACUGCACUUACCGAACUAGAU.....AACGGUGUAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCG-
.............................................................<.<<...>>...>..<<..........<<......> >.......<<<<<<<<<<.........................>>>>>>>>>>>>........<<<<..<...>>>>>.
K02709.1 0.00 .UAGGCAGGAAGUGGUUGGACUCCUUUUAGAUUAGAGACAAUUGAAACAAUUUAGAU UGGCACAACCCUACUGUGCUAACCGAACCAGAU.....AACGGUACAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCG-
.....................<.<<...>>...>..<<.........<<......> >.......<<<<<<<<<<.........................>>>>>>>>>>>>........<<<<..<...>>>>>.
M16560.1 0.00 .AGGAAGUGGUUGGACUCUUUUUAAAUUAGAGACAAUUUGAACUAAUUUUAAU UGGCUUAACCCUACCGCACUAACCGAACUAGAU.....AACGGUGCAGUGGGGGUAAAUUCUCCGCA..UUCGGUGCG-
................<.<<...>>...>..<<..........<<......> >.......<<<<<<.<<<.........................>>>.>>>>>>>>........<<<<..<...>>>>>.
M27727.1 0.00 .UUAGAGGCAAUUUGAAAUAAUUUAAAU UAGCUCAACCCUACUGCACUUACCGAACUAGAU.....AACGGUGUAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
......<<..........<<......> >.......<<<<<<<<<<.........................>>>>>>>>>>>>.......<<<<<..<...>>>>>>
M33854.1 0.00 .ACUCUACGCAGGAAGUGGUUGGACUCCUUUUAGAUUAGAGACAAUUUGAAAUAAUUUAGAU UGGCUUAACCCUACUGUGCUAACCGAACCAGAU.....AACGGUACAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
.........................<.<<...>>...>..<<..........<<......> >.......<<<<<<<<<<.........................>>>>>>>>>>>>.......<<<<<..<...>>>>>>
S76772.1 0.00 .CGAUCCUUGUGCUUGUUAGCCUGGCAUAAUGGAGAGCAAGAGUAUGAAGAGUUGUAUCCAAAAAUCAGGAGCGUUCCAGUGGGGCGCUGUUUGACCCUGCCUGCGUUCUCUACUCUACGCAGGAAGUGGCUAGACGCUUUUUAAAUUAGACACAAUUUGGUUUAAUUCCAAU UGGCUUAACCCUACUGCACUCACCGAAGUAGAU.....AACGGUGUGGUCGGGGUAAAUUCUCCGCA..UUCGGUGCGGA
........................................................................................................................................<.<<...>>...>..<<..........<<......> >.......<<<.<<<<<<.........................>>>>>>.>>>>>.......<<<<<..<...>>>>>> .
U16283.1 0.00 .AAUAAUUUAAAU UAGCUCAACCCUACUGCACUUACCGAACUAGAU.....AAUGGUGUAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
...<<......> >.......<<<<<<<<<<.........................>>>>>>>>>>.........<<<<<..<...>>>>>>
V01148.1 0.00 .AGAUCCUAGGAACACUCAGGAUCACGUUCGCUCUCUGUGCCUUUUAGCUUGGCACAAUGGCGAAGAAGAAUAUAACAAAUUCCUAGCUAAAAUCAGGAGUGUGCCAAUUGGAAGAGCUUUAUUGCUCCCAGAGUACUCAACAUUGUACCGCCGUUGGCUUGACUCAUUU --UAGUAACCCUACCUCAGU---CGAAUUGGAUuggguCAUACUGCUGUAGGGGUAAAUUUUUCUUUaaUUCGGAG--G
...........................................................................................................................<.<<...>>...>...<<..............<<......>>.... __......<<<<<<..<<.........................>>..>>>>>>>>.......<<<...>...>>.....
X00595.1 0.00 .UUGCUCCCGGAGUACUCUACAUUGUACCGCCGUUGGCUCGACUCUUUU --UAGUAACCCUACCUCAGU---CGAAUUGGAUuggguCAUGCUGUUGUAGGGGUAAAUUUUUCUUUaaUUCGGGG---
..<.<<...>>...>...<<..............<<......>>.... __......<<<<<<..<<.........................>>..>>>>>>>>.......<<<...>...>>.....
X04468.1 0.00 .AAUGGAGAGGACGAAUACAAUAAAUUUUUAGCUAUGAUCAGAAGCGUGCCAAUUGGAAGGGCUCUAUUGCUCCCUGAGUACUCUACAUUGUACCGCCGUUGGCUCGACUCUUUU --UAGCAACCCUACCUCAGU---CGAAUUGGAUuggguCAUACUGUUGUAGGGGUAAAUUUUUCUUUaaUUCGGAG---
....................................................................<.<<...>>...>...<<..............<<......>>.... __......<<<<<<..<<.........................>>..>>>>>>>>.......<<<...>...>>.....
X05690.1 0.00 .GGUUGGAUUCCUUUUAAAUUAGAGACAAUUUGAAACAAUUUAAAU UGGCUUAACCCUACUGCACUAACCGAACUAGAU.....AACGGUGCAGUAGGGGUAAAUUCUCCGCG..UUCGGUGCGG
.........<.<<...>>...>..<<..........<<......> >.......<<<<<<<<<<.........................>>>>>>>>>>>>.......<<<<<..<...>>>>>>
X54521.1 0.00 .GAGGAGUUUAUUCGUAAGAUCAGAAGCGUCCGCGUAGGGCGCUGCUUGUCCCUCCCUGCGUUUUCAACGCUGCGCAGGAAGUGGUUGGACUCCUUUUAAAAUUAGAGCACAAUUAGUCAAUCAUAAU UGGCUCAACCCUACCGCAUGAACCGAACUUGAU.....AAAAGUGCGGUAGGGGUAAAUUCUCCGUA..UUCGGUGCGG
...........................................................................................<.<<....>>...>...<<........<<......> >.......<<<<<<<<<<.........................>>>>>>>>>>>>.......<<<<<..<...>>>>>>
X67706.1 0.00 .CCAAAAAAUACCCAAGACCAUGUGCGUUCAUUGUGCUUAUUGGCUUGGCACAAUGGAGAACACGAAUAUGAGGAGUUUAUCAAAAAAAUCAGAAGCGUCCCAGUUGGGCGUUGCUUGACCUUGCCUGCGUUUUCAACUUUACGCAGGAAAUGGUUGGACUCCUUUUAGAUUAGAGGCAAUUUCAAUUGAUUAGAAU UGGCUUAACCCUACCGCACCAACCGAACUAGAC.....AACGGUGCGGUAGGGGUAAAUUAUCCGCA..UUCGGUGCGGG
................................................................................................................................................................<.<<...>>...>..<<..........<<......> >.......<<<<<<<<<<.........................>>>>>>>>>>>>.......<<<<<..<...>>>>>> .
X77708.1 0.00 .UGGCUUGGCAUAACGGAGAACAAGAAUAUGAGGAAUUCAUCCGAAAGAUCAGAAGCGUCCCGGUUGGGCGCUGUCUGACUCUCCCCGCGUUUUCAACUUUACGCAGAAAAUGGCUGGAUUCCUUUUAAAUUAGAGACAAUUUGAAAUAAUUUAAAU UGGCUUAACCCUACUGUACUAACCGAACUAGAC.....AACGGUGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCG-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
........................................................................................................................<.<<...>>...>..<<..........<<......> >.......<<<<<<<<<<.........................>>>>>>>>>>>>........<<<<..<...>>>>>. ............................................
X84981.1 0.00 .AUGUGCGCUCGCUAUGUCUAUUGGCCUGGCACAACGGGGAGCGCGAAUAUGAAGAGUUCAUCCGCAAAAUCAGAAGCGUCCCAGUAGGACGAUGUUUGACUCUACCUGCGUUUUCAACCCUACGCAGGAAGUGGUUGGACUCCUUCUAAAGUAGAGACAAUUUGAUCUAACUUGAAU UGGCUUAACCUUACUGCACUAACCGAACUAGAU.....AACGGUGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCG-
.............................................................................................................................................<.<<...>>...>..<<..........<<......> >.......<<<<<<<<<<.........................>>>>>>>>>>>>........<<<<..<...>>>>>.
X92886.1 0.00 .U UGGCUUAACCCUACCGCAUGAACCGAACUUGAU.....ACAAGUGCGGUAGGGGUAAAUUCUCCGCA..UUCGGUGCG-
. ........<<<<<<<<<<.........................>>>>>>>>>>..........<<<<..<...>>>>>.