Seq ID Score (bits) Sequence
AF029859.2 1.00 .AGAGCACAAUUAGUAGAUUAAAU UGGCUUAACCCUACCGCAUGAACCGAACUUGAU.....AAAAGUGCGGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
....................... ....<<<.<<<<<<<<<<<.......................>>>>>>>>>>>.>>>......................
AF083069.1 1.00 .AGAACACUCAAGAUCAUGUGCGCUCACUGUGUCUAUUGGCCUGGCACAACGGAGAGCACGAAUAUGAGGAGUUCAUCCGUAAAAUUAGAAGCGUCCCAGUCGGACGUUGCUUGACCCUCCCUGCGUUUUCAACCCUGCGCAGGAAAUGGUUGGACUCUUUCUGAAUUAGAGACAAUUUGAAAUAAUUUGAAU UGGCUUAACCCUACUGUACUAACCGAACUAGAU.....AACGGUGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
................................................................................................................................................................................................ ....<<<.<<<<<<<<<<<<.....................>>>>>>>>>>>>.>>>......................
AF085363.1 1.00 .AUUGGCCUGGCACAAUGGAGAGCACGAGUAUGAGGAGUUCAUCCGCAAAAUCAGGAGCGUCCCGGUCGGACGUUGCUUGUCUCUGCCUGCGUUUUCGACCUUGCGCAGGAAGUGGUUGGACUCUUUUUAAAUUAGAGACAAUUUGAACUAAUUUGAGU UGGCUUAACCCUACUGCAUCAACCGAACUAGAC.....AACGGUGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGGAGGAG
.............................................................................................................................................................. ....<<<.<<<<<<<<<<<<.....................>>>>>>>>>>>>.>>>...................... .....
AF114383.1 1.00 .CUUUCUAAAUUGGAGACAAUUUGAGAUAAUUUGAAU UGGCUUAACCCUACCGCACUAACCGAACUAGAU.....AACGGUGCGGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
.................................... ....<<<.<<<<<<<<<<<<.....................>>>>>>>>>>>>.>>>......................
AF114384.1 1.00 .AUUCAUUCGAAAGGUCAGAAGCGUUCCUGUUGGACGCUGUUUGACUCUACCUGCGUUCUCGACACUACGCAGAAAGUGGUUGGAUUCCUUCUAAAUUAGAGACAAUUCGAUAAAAUUUGAAU UGGCUUAACCCUACUGCGCUAACCGAACUAGAC.....AACGGCGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
.......................................................................................................................... ....<<<.<<<<<<<<<<<<.....................>>>>>>>>>>>>.>>>......................
AF162711.1 1.00 .UGGCUAGACUCUUUUUAGAUUAGAGUACAAUUAUAUAAUUUUAAUUUUAAU UGGCUUAACCCUACCACACUUACCGAACUAGAC.....AACGGUGUGGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
................................................... ....<<<.<<<<<<<<<<<<.....................>>>>>>>>>>>>.>>>......................
AF230973.1 1.00 .UCAUCCAGACAGAUCAGAUAGCAUCCCAGUUGGGCGCUGUUUGACUUUACCUGCGUUUUCAACCCUGCGCAGGAAAUGGUUGGACUCUUUUUAGAUUAGAGACAAUUUGAAUAAUUUAAAU UGGCUUAACCCUACUGCAUUAACCGAACUAGAC.....AACAAUGCAGUAGGGGUAAAUUUUCCGCG..UUCGGUGCGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
......................................................................................................................... ....<<<.<<<<<<<<<<<<.....................>>>>>>>>>>>>.>>>...................... ..................................................
AF241359.1 1.00 .CUCUUUUUAAAUUAGAGACAAUUUGAAAUAAUUUGAAU UGGCUUAACCCUACUGUACUAACCGAACUAGAU.....AACGGUACAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
...................................... ....<<<.<<<<<<<<<<<<.....................>>>>>>>>>>>>.>>>......................
AF268065.1 1.00 .CAAUUAAUCAAUUACAAU UGGCUCAACCCUACCGCAUGAACCGAACUU-AC.....AAAAGUGCGGCAGGGGUAAAUUUUCCGUG..UUCGGUGCGGAAAAAA
.................. ............................................................................... ......
AF317694.1 1.00 .CCAGUAGGGCGAUGUUUGACUCUACCUGCGUUCUCAACCCUACGCAGGAAGUGGUUGGACUCCUUCUAAAGUAGAGACAAUUUGAUCUAAUUUGAAU UGGCUUAACCCUACUGCACUAACCGAACUAGAU.....AACGGUGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
................................................................................................. ....<<<.<<<<<<<<<<<<.....................>>>>>>>>>>>>.>>>......................
AF405682.1 1.00 .UCACUGUGCCUAUUGGCAUGGCACAAUGGCGAAGAAGAAUACAAUAAAUUCUUAGCUAAAAUAAGAAGUGUGCCAAUCGGAAGAGCAUUGUUGCUCCCUGAGUACUCAACCUUGUACCGCCGUUGGCUCGACUCAUUU --UAGUAACCCUACCUCAGU---CGAAUUGGAUuggguCAUACUGUUGUAGGGGUAAAUUUUUCUUUaaUUCGGAG---A
.......................................................................................................................................... __............................................................................. .
AF405690.1 1.00 .AUCAGAUGGACUAAGGAUCCUAGGAACACCCAGGAUCAUGUUCGCUCACUGUGCCUAUUGGCCUGGCACAAUGGCGAAGAAGAAUACAACAAAUUUUUAGCUAAAAUCAGAAGCGUGCCAAUCGGCAGAGCUUUACUGCUCCCCGAAUACUCUACGCUGUACCGCCGUUGGCUCGACUCAUUU --UAGUAACCCUACCUCAGU---CGAAUUGGAUuggguCAUACUGUUGUAGGGGUAAAUUUUUCUUUgaUUCGGAG---A
....................................................................................................................................................................................... __............................................................................. .
AJ132961.1 1.00 .AACAAAUUUUUAGCUAAAAUUAGGAGUGUGCCAAUUGGAAGGGCUUUAUUGCUCCCAGAGUACUCAACGUUGUAUCGUCGUUGGCUUGACUCAUUU --UAGUAACCCUACCUCAGU---CGAAUUGGAUuggguCAUACUGAUGUAGGGGUAAAUUUUUCUUUaaUUCGGGG---
................................................................................................ __.............................................................................
AJ245864.1 1.00 .GCUUGGCUCUUCCUGCGUUCUCAACACUGCGCAGGAAGUGGUUGGACUCCUUCUAGAAGUAGAGCACAAUUUGUAAAUUACAAU UGGCUCAACCCUACCGCAUGAACCGAACUUGAC.....AAAAGUGCAGUAGGGGUAAAUUCUCCCGA..UUCGGUGCGGAGGAGAAAA
.................................................................................... ............................................................................... .........
AJ276224.1 1.00 .AAUACCCAGGACCAUGUUCGAUCCUUGUGCCUAUUGGCCUGGCACAAUGGCGAGCAAGAAUACGAAGAAUUUGUGUCCAAAAUCAGGAGCGUUCCAGUAGGGCGCUGUUUGACUUUGCCUGCAUUCUCAACUCUACGCAGGAAAUGGCUGGAUUCUUUUUAAAUUAGAGUACAAUUUGGUUAAAUUCCAAU UGGCUUAACCCUACCACACUCACCGAACUAGAU.....AACGGUGUGGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
............................................................................................................................................................................................... ....<<<.<<<<<<<<<<<<.....................>>>>>>>>>>>>.>>>......................
AY036578.1 1.00 .GUGGUUGGAUUCCUUUUGAACUAGAGACAAUUUGAUACAAUUUGAAU UGGCUUAACCCUACUACACUUACCGAACUAGAC.....AGCGGUGUAGUGGGGGUAAAUUCUCCGCA..UUCGGUGCGG
............................................... ....<<<.<<<<<<<<<<<<.....................>>>>>>>>>>>>.>>>......................
AY036579.1 1.00 .UGAAU UGGCUUAACCCUACUGCACUAACCGAACUAGAU.....AACGGCGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
..... ....<<<.<<<<<<<<<.<<.....................>>.>>>>>>>>>.>>>......................
D00625.1 1.00 .CAAUAAAUUUUUAGCUAAGAUUAGAAGUGUGCCAAUCGGAAGAGCUUUACUGCUCCCUGAGUACUCCACAUUGUACCGCCGUUGGCUCGACUCAUUU --UAGUAACCCUACCUCAGU---CGAAUUGGAUuggguCAUACUGUUGUAGGGGUAAAUUUUUCUUUaaUUCGGAG--G
................................................................................................. __.............................................................................
D00627.1 1.00 .CCAAAGAACACCCAAGACCACGUGCGCUCGCUAUGCUUAUUAGCUUGGCACAACGGGGAGCACGAAUAUGAGGAGUUCAUUCGCAAAAUCAGGAGCGUCCCAGUUGGACGUUGUUUGACCCUACCUGCGUUCUCAACCCUACGCAGGAAGUGGUUGGACUCUUUCUAAAUUAGAGACAAUUUGAACUGAUUUGAAU UGGCUCAACCCUACUGUACUAACCGAACUAGAU.....AACGGUGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGGAGG
.................................................................................................................................................................................................... ........<<<<<<<<<<<<.....................>>>>>>>>>>>>.......................... ...
D10582.1 1.00 .CCGGUCGGACGUUGCUUGACUCUGCCCGCAUUUUCAACCUUGCGUAGGAAGUGGUUGGACUCUUUUUAAACUAGAGACAAUUUGAACUAAUUUGAAU UGGCUUAACCCUACUGCACUUACCGAACUAGAU.....AACGGUGUAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCG-
................................................................................................. ....<<<.<<<<<<<<<<<<.....................>>>>>>>>>>>>.>>>......................
K02709.1 1.00 .UAGGCAGGAAGUGGUUGGACUCCUUUUAGAUUAGAGACAAUUGAAACAAUUUAGAU UGGCACAACCCUACUGUGCUAACCGAACCAGAU.....AACGGUACAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCG-
........................................................ ........<<<<<<<<<<<<.....................>>>>>>>>>>>>..........................
M16560.1 1.00 .AGGAAGUGGUUGGACUCUUUUUAAAUUAGAGACAAUUUGAACUAAUUUUAAU UGGCUUAACCCUACCGCACUAACCGAACUAGAU.....AACGGUGCAGUGGGGGUAAAUUCUCCGCA..UUCGGUGCG-
.................................................... ....<<<.<<<<<<.<<<<<.....................>>>>>.>>>>>>.>>>......................
M27727.1 1.00 .UUAGAGGCAAUUUGAAAUAAUUUAAAU UAGCUCAACCCUACUGCACUUACCGAACUAGAU.....AACGGUGUAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
........................... ........<<<<<<<<<<<<.....................>>>>>>>>>>>>..........................
M33854.1 1.00 .ACUCUACGCAGGAAGUGGUUGGACUCCUUUUAGAUUAGAGACAAUUUGAAAUAAUUUAGAU UGGCUUAACCCUACUGUGCUAACCGAACCAGAU.....AACGGUACAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
............................................................. ....<<<.<<<<<<<<<<<<.....................>>>>>>>>>>>>.>>>......................
S76772.1 1.00 .CGAUCCUUGUGCUUGUUAGCCUGGCAUAAUGGAGAGCAAGAGUAUGAAGAGUUGUAUCCAAAAAUCAGGAGCGUUCCAGUGGGGCGCUGUUUGACCCUGCCUGCGUUCUCUACUCUACGCAGGAAGUGGCUAGACGCUUUUUAAAUUAGACACAAUUUGGUUUAAUUCCAAU UGGCUUAACCCUACUGCACUCACCGAAGUAGAU.....AACGGUGUGGUCGGGGUAAAUUCUCCGCA..UUCGGUGCGGA
............................................................................................................................................................................ ............................................................................... .
U16283.1 1.00 .AAUAAUUUAAAU UAGCUCAACCCUACUGCACUUACCGAACUAGAU.....AAUGGUGUAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
............ ........<<<<<<<<<<<<.....................>>>>>>>>>>>>..........................
V01148.1 1.00 .AGAUCCUAGGAACACUCAGGAUCACGUUCGCUCUCUGUGCCUUUUAGCUUGGCACAAUGGCGAAGAAGAAUAUAACAAAUUCCUAGCUAAAAUCAGGAGUGUGCCAAUUGGAAGAGCUUUAUUGCUCCCAGAGUACUCAACAUUGUACCGCCGUUGGCUUGACUCAUUU --UAGUAACCCUACCUCAGU---CGAAUUGGAUuggguCAUACUGCUGUAGGGGUAAAUUUUUCUUUaaUUCGGAG--G
......................................................................................................................................................................... __.............................................................................
X00595.1 1.00 .UUGCUCCCGGAGUACUCUACAUUGUACCGCCGUUGGCUCGACUCUUUU --UAGUAACCCUACCUCAGU---CGAAUUGGAUuggguCAUGCUGUUGUAGGGGUAAAUUUUUCUUUaaUUCGGGG---
................................................ __.............................................................................
X04468.1 1.00 .AAUGGAGAGGACGAAUACAAUAAAUUUUUAGCUAUGAUCAGAAGCGUGCCAAUUGGAAGGGCUCUAUUGCUCCCUGAGUACUCUACAUUGUACCGCCGUUGGCUCGACUCUUUU --UAGCAACCCUACCUCAGU---CGAAUUGGAUuggguCAUACUGUUGUAGGGGUAAAUUUUUCUUUaaUUCGGAG---
.................................................................................................................. __.............................................................................
X05690.1 1.00 .GGUUGGAUUCCUUUUAAAUUAGAGACAAUUUGAAACAAUUUAAAU UGGCUUAACCCUACUGCACUAACCGAACUAGAU.....AACGGUGCAGUAGGGGUAAAUUCUCCGCG..UUCGGUGCGG
............................................. ....<<<.<<<<<<<<<<<<.....................>>>>>>>>>>>>.>>>......................
X54521.1 1.00 .GAGGAGUUUAUUCGUAAGAUCAGAAGCGUCCGCGUAGGGCGCUGCUUGUCCCUCCCUGCGUUUUCAACGCUGCGCAGGAAGUGGUUGGACUCCUUUUAAAAUUAGAGCACAAUUAGUCAAUCAUAAU UGGCUCAACCCUACCGCAUGAACCGAACUUGAU.....AAAAGUGCGGUAGGGGUAAAUUCUCCGUA..UUCGGUGCGG
............................................................................................................................... ........<<<<<<<<<<<.......................>>>>>>>>>>>..........................
X67706.1 1.00 .CCAAAAAAUACCCAAGACCAUGUGCGUUCAUUGUGCUUAUUGGCUUGGCACAAUGGAGAACACGAAUAUGAGGAGUUUAUCAAAAAAAUCAGAAGCGUCCCAGUUGGGCGUUGCUUGACCUUGCCUGCGUUUUCAACUUUACGCAGGAAAUGGUUGGACUCCUUUUAGAUUAGAGGCAAUUUCAAUUGAUUAGAAU UGGCUUAACCCUACCGCACCAACCGAACUAGAC.....AACGGUGCGGUAGGGGUAAAUUAUCCGCA..UUCGGUGCGGG
.................................................................................................................................................................................................... ....<<<.<<<<<<<<<<<<.....................>>>>>>>>>>>>.>>>...................... .
X77708.1 1.00 .UGGCUUGGCAUAACGGAGAACAAGAAUAUGAGGAAUUCAUCCGAAAGAUCAGAAGCGUCCCGGUUGGGCGCUGUCUGACUCUCCCCGCGUUUUCAACUUUACGCAGAAAAUGGCUGGAUUCCUUUUAAAUUAGAGACAAUUUGAAAUAAUUUAAAU UGGCUUAACCCUACUGUACUAACCGAACUAGAC.....AACGGUGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCG-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
............................................................................................................................................................ ....<<<.<<<<<<<<<<<<.....................>>>>>>>>>>>>.>>>...................... ............................................
X84981.1 1.00 .AUGUGCGCUCGCUAUGUCUAUUGGCCUGGCACAACGGGGAGCGCGAAUAUGAAGAGUUCAUCCGCAAAAUCAGAAGCGUCCCAGUAGGACGAUGUUUGACUCUACCUGCGUUUUCAACCCUACGCAGGAAGUGGUUGGACUCCUUCUAAAGUAGAGACAAUUUGAUCUAACUUGAAU UGGCUUAACCUUACUGCACUAACCGAACUAGAU.....AACGGUGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCG-
................................................................................................................................................................................. ....<<<.<<<<<<<<<<<<.....................>>>>>>>>>>>>.>>>......................
X92886.1 1.00 .U UGGCUUAACCCUACCGCAUGAACCGAACUUGAU.....ACAAGUGCGGUAGGGGUAAAUUCUCCGCA..UUCGGUGCG-
. ....<<<.<<<<<<<<<<<.......................>>>>>>>>>>>.>>>......................