Seq ID Score (bits) Sequence
AF029859.2 0.00 .AGAGCACAATTAGTAGATTAAAT UGGCUUAACCCUACCGCAUGAACCGAACUUGAU.....AAAAGUGCGGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
....................... ........<<<<<<<<<<<.......................>>>>>>>>>>>..........................
AF083069.1 0.00 .AGAACACTCAAGATCATGTGCGCTCACTGTGTCTATTGGCCTGGCACAACGGAGAGCACGAATATGAGGAGTTCATCCGTAAAATTAGAAGCGTCCCAGTCGGACGTTGCTTGACCCTCCCTGCGTTTTCAACCCTGCGCAGGAAATGGTTGGACTCTTTCTGAATTAGAGACAATTTGAAATAATTTGAAT UGGCUUAACCCUACUGUACUAACCGAACUAGAU.....AACGGUGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
................................................................................................................................................................................................ ........<<<<<<<<<<<<.....................>>>>>>>>>>>>..........................
AF085363.1 0.00 .ATTGGCCTGGCACAATGGAGAGCACGAGTATGAGGAGTTCATCCGCAAAATCAGGAGCGTCCCGGTCGGACGTTGCTTGTCTCTGCCTGCGTTTTCGACCTTGCGCAGGAAGTGGTTGGACTCTTTTTAAATTAGAGACAATTTGAACTAATTTGAGT UGGCUUAACCCUACUGCAUCAACCGAACUAGAC.....AACGGUGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGGAGGAG
.............................................................................................................................................................. ........<<<<<<<<<<<<.....................>>>>>>>>>>>>.......................... .....
AF114383.1 0.00 .CTTTCTAAATTGGAGACAATTTGAGATAATTTGAAT UGGCUUAACCCUACCGCACUAACCGAACUAGAU.....AACGGUGCGGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
.................................... ........<<<<<<<<<<<<.....................>>>>>>>>>>>>..........................
AF114384.1 0.00 .ATTCATTCGAAAGGTCAGAAGCGTTCCTGTTGGACGCTGTTTGACTCTACCTGCGTTCTCGACACTACGCAGAAAGTGGTTGGATTCCTTCTAAATTAGAGACAATTCGATAAAATTTGAAT UGGCUUAACCCUACUGCGCUAACCGAACUAGAC.....AACGGCGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
.......................................................................................................................... ........<<<<<<<<<<<<.....................>>>>>>>>>>>>..........................
AF162711.1 0.00 .TGGCTAGACTCTTTTTAGATTAGAGTACAATTATATAATTTTAATTTTAAT UGGCUUAACCCUACCACACUUACCGAACUAGAC.....AACGGUGUGGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
................................................... ........<<<<<<<<<<<<.....................>>>>>>>>>>>>..........................
AF230973.1 0.00 .TCATCCAGACAGATCAGATAGCATCCCAGTTGGGCGCTGTTTGACTTTACCTGCGTTTTCAACCCTGCGCAGGAAATGGTTGGACTCTTTTTAGATTAGAGACAATTTGAATAATTTAAAT UGGCUUAACCCUACUGCAUUAACCGAACUAGAC.....AACAAUGCAGUAGGGGUAAAUUUUCCGCG..UUCGGUGCGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
......................................................................................................................... ........<<<<<<<<<<<<.....................>>>>>>>>>>>>.......................... ..................................................
AF241359.1 0.00 .CTCTTTTTAAATTAGAGACAATTTGAAATAATTTGAAT UGGCUUAACCCUACUGUACUAACCGAACUAGAU.....AACGGUACAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
...................................... ........<<<<<<<<<<<<.....................>>>>>>>>>>>>..........................
AF268065.1 0.00 .CAATTAATCAATTACAAT UGGCUCAACCCUACCGCAUGAACCGAACUU-AC.....AAAAGUGCGGCAGGGGUAAAUUUUCCGUG..UUCGGUGCGGAAAAAA
.................. ........<<<<<<<<<<<.......................>>>>>>>>>>>.......................... ......
AF317694.1 0.00 .CCAGTAGGGCGATGTTTGACTCTACCTGCGTTCTCAACCCTACGCAGGAAGTGGTTGGACTCCTTCTAAAGTAGAGACAATTTGATCTAATTTGAAT UGGCUUAACCCUACUGCACUAACCGAACUAGAU.....AACGGUGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
................................................................................................. ........<<<<<<<<<<<<.....................>>>>>>>>>>>>..........................
AF405682.1 0.00 .TCACTGTGCCTATTGGCATGGCACAATGGCGAAGAAGAATACAATAAATTCTTAGCTAAAATAAGAAGTGTGCCAATCGGAAGAGCATTGTTGCTCCCTGAGTACTCAACCTTGTACCGCCGTTGGCTCGACTCATTT --UAGUAACCCUACCUCAGU---CGAAUUGGAUuggguCAUACUGUUGUAGGGGUAAAUUUUUCUUUaaUUCGGAG---A
.......................................................................................................................................... __......<<<<<<<<<<<<.....................>>>>>>>>>>>>.......................... .
AF405690.1 0.00 .ATCAGATGGACTAAGGATCCTAGGAACACCCAGGATCATGTTCGCTCACTGTGCCTATTGGCCTGGCACAATGGCGAAGAAGAATACAACAAATTTTTAGCTAAAATCAGAAGCGTGCCAATCGGCAGAGCTTTACTGCTCCCCGAATACTCTACGCTGTACCGCCGTTGGCTCGACTCATTT --UAGUAACCCUACCUCAGU---CGAAUUGGAUuggguCAUACUGUUGUAGGGGUAAAUUUUUCUUUgaUUCGGAG---A
....................................................................................................................................................................................... __......<<<<<<<<<<<<.....................>>>>>>>>>>>>.......................... .
AJ132961.1 0.00 .AACAAATTTTTAGCTAAAATTAGGAGTGTGCCAATTGGAAGGGCTTTATTGCTCCCAGAGTACTCAACGTTGTATCGTCGTTGGCTTGACTCATTT --UAGUAACCCUACCUCAGU---CGAAUUGGAUuggguCAUACUGAUGUAGGGGUAAAUUUUUCUUUaaUUCGGGG---
................................................................................................ __......<<<<<<<<<<<<.....................>>>>>>>>>>>>..........................
AJ245864.1 0.00 .GCTTGGCTCTTCCTGCGTTCTCAACACTGCGCAGGAAGTGGTTGGACTCCTTCTAGAAGTAGAGCACAATTTGTAAATTACAAT UGGCUCAACCCUACCGCAUGAACCGAACUUGAC.....AAAAGUGCAGUAGGGGUAAAUUCUCCCGA..UUCGGUGCGGAGGAGAAAA
.................................................................................... ........<<<<<<<<<<<.......................>>>>>>>>>>>.......................... .........
AJ276224.1 0.00 .AATACCCAGGACCATGTTCGATCCTTGTGCCTATTGGCCTGGCACAATGGCGAGCAAGAATACGAAGAATTTGTGTCCAAAATCAGGAGCGTTCCAGTAGGGCGCTGTTTGACTTTGCCTGCATTCTCAACTCTACGCAGGAAATGGCTGGATTCTTTTTAAATTAGAGTACAATTTGGTTAAATTCCAAT UGGCUUAACCCUACCACACUCACCGAACUAGAU.....AACGGUGUGGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
............................................................................................................................................................................................... ........<<<<<<<<<<<<.....................>>>>>>>>>>>>..........................
AY036578.1 0.00 .GTGGTTGGATTCCTTTTGAACTAGAGACAATTTGATACAATTTGAAT UGGCUUAACCCUACUACACUUACCGAACUAGAC.....AGCGGUGUAGUGGGGGUAAAUUCUCCGCA..UUCGGUGCGG
............................................... ........<<<<<<<<<<<<.....................>>>>>>>>>>>>..........................
AY036579.1 0.00 .TGAAT UGGCUUAACCCUACUGCACUAACCGAACUAGAU.....AACGGCGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
..... ........<<<<<<<<<...........................>>>>>>>>>..........................
D00625.1 0.00 .CAATAAATTTTTAGCTAAGATTAGAAGTGTGCCAATCGGAAGAGCTTTACTGCTCCCTGAGTACTCCACATTGTACCGCCGTTGGCTCGACTCATTT --UAGUAACCCUACCUCAGU---CGAAUUGGAUuggguCAUACUGUUGUAGGGGUAAAUUUUUCUUUaaUUCGGAG--G
................................................................................................. __......<<<<<<<<<<<<.....................>>>>>>>>>>>>..........................
D00627.1 0.00 .CCAAAGAACACCCAAGACCACGTGCGCTCGCTATGCTTATTAGCTTGGCACAACGGGGAGCACGAATATGAGGAGTTCATTCGCAAAATCAGGAGCGTCCCAGTTGGACGTTGTTTGACCCTACCTGCGTTCTCAACCCTACGCAGGAAGTGGTTGGACTCTTTCTAAATTAGAGACAATTTGAACTGATTTGAAT UGGCUCAACCCUACUGUACUAACCGAACUAGAU.....AACGGUGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGGAGG
.................................................................................................................................................................................................... ........<<<<<<<<<<<<.....................>>>>>>>>>>>>.......................... ...
D10582.1 0.00 .CCGGTCGGACGTTGCTTGACTCTGCCCGCATTTTCAACCTTGCGTAGGAAGTGGTTGGACTCTTTTTAAACTAGAGACAATTTGAACTAATTTGAAT UGGCUUAACCCUACUGCACUUACCGAACUAGAU.....AACGGUGUAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCG-
................................................................................................. ........<<<<<<<<<<<<.....................>>>>>>>>>>>>..........................
K02709.1 0.00 .TAGGCAGGAAGTGGTTGGACTCCTTTTAGATTAGAGACAATTGAAACAATTTAGAT UGGCACAACCCUACUGUGCUAACCGAACCAGAU.....AACGGUACAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCG-
........................................................ ........<<<<<<<<<<<<.....................>>>>>>>>>>>>..........................
M16560.1 0.00 .AGGAAGTGGTTGGACTCTTTTTAAATTAGAGACAATTTGAACTAATTTTAAT UGGCUUAACCCUACCGCACUAACCGAACUAGAU.....AACGGUGCAGUGGGGGUAAAUUCUCCGCA..UUCGGUGCG-
.................................................... ........<<<<<<<<<<<<.....................>>>>>>>>>>>>..........................
M27727.1 0.00 .TTAGAGGCAATTTGAAATAATTTAAAT UAGCUCAACCCUACUGCACUUACCGAACUAGAU.....AACGGUGUAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
........................... ........<<<<<<<<<<<<.....................>>>>>>>>>>>>..........................
M33854.1 0.00 .ACTCTACGCAGGAAGTGGTTGGACTCCTTTTAGATTAGAGACAATTTGAAATAATTTAGAT UGGCUUAACCCUACUGUGCUAACCGAACCAGAU.....AACGGUACAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
............................................................. ........<<<<<<<<<<<<.....................>>>>>>>>>>>>..........................
S76772.1 0.00 .CGATCCTTGTGCTTGTTAGCCTGGCATAATGGAGAGCAAGAGTATGAAGAGTTGTATCCAAAAATCAGGAGCGTTCCAGTGGGGCGCTGTTTGACCCTGCCTGCGTTCTCTACTCTACGCAGGAAGTGGCTAGACGCTTTTTAAATTAGACACAATTTGGTTTAATTCCAAT UGGCUUAACCCUACUGCACUCACCGAAGUAGAU.....AACGGUGUGGUCGGGGUAAAUUCUCCGCA..UUCGGUGCGGA
............................................................................................................................................................................ ........<<<<<<<<<<<<.....................>>>>>>>>>>>>.......................... .
U16283.1 0.00 .AATAATTTAAAT UAGCUCAACCCUACUGCACUUACCGAACUAGAU.....AAUGGUGUAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
............ ........<<<<<<<<<<<<.....................>>>>>>>>>>>>..........................
V01148.1 0.00 .AGATCCTAGGAACACTCAGGATCACGTTCGCTCTCTGTGCCTTTTAGCTTGGCACAATGGCGAAGAAGAATATAACAAATTCCTAGCTAAAATCAGGAGTGTGCCAATTGGAAGAGCTTTATTGCTCCCAGAGTACTCAACATTGTACCGCCGTTGGCTTGACTCATTT --UAGUAACCCUACCUCAGU---CGAAUUGGAUuggguCAUACUGCUGUAGGGGUAAAUUUUUCUUUaaUUCGGAG--G
......................................................................................................................................................................... __......<<<<<<<<<<<<.....................>>>>>>>>>>>>..........................
X00595.1 0.00 .TTGCTCCCGGAGTACTCTACATTGTACCGCCGTTGGCTCGACTCTTTT --UAGUAACCCUACCUCAGU---CGAAUUGGAUuggguCAUGCUGUUGUAGGGGUAAAUUUUUCUUUaaUUCGGGG---
................................................ __......<<<<<<<<<<<<.....................>>>>>>>>>>>>..........................
X04468.1 0.00 .AATGGAGAGGACGAATACAATAAATTTTTAGCTATGATCAGAAGCGTGCCAATTGGAAGGGCTCTATTGCTCCCTGAGTACTCTACATTGTACCGCCGTTGGCTCGACTCTTTT --UAGCAACCCUACCUCAGU---CGAAUUGGAUuggguCAUACUGUUGUAGGGGUAAAUUUUUCUUUaaUUCGGAG---
.................................................................................................................. __......<<<<<<<<<<<<.....................>>>>>>>>>>>>..........................
X05690.1 0.00 .GGTTGGATTCCTTTTAAATTAGAGACAATTTGAAACAATTTAAAT UGGCUUAACCCUACUGCACUAACCGAACUAGAU.....AACGGUGCAGUAGGGGUAAAUUCUCCGCG..UUCGGUGCGG
............................................. ........<<<<<<<<<<<<.....................>>>>>>>>>>>>..........................
X54521.1 0.00 .GAGGAGTTTATTCGTAAGATCAGAAGCGTCCGCGTAGGGCGCTGCTTGTCCCTCCCTGCGTTTTCAACGCTGCGCAGGAAGTGGTTGGACTCCTTTTAAAATTAGAGCACAATTAGTCAATCATAAT UGGCUCAACCCUACCGCAUGAACCGAACUUGAU.....AAAAGUGCGGUAGGGGUAAAUUCUCCGUA..UUCGGUGCGG
............................................................................................................................... ........<<<<<<<<<<<.......................>>>>>>>>>>>..........................
X67706.1 0.00 .CCAAAAAATACCCAAGACCATGTGCGTTCATTGTGCTTATTGGCTTGGCACAATGGAGAACACGAATATGAGGAGTTTATCAAAAAAATCAGAAGCGTCCCAGTTGGGCGTTGCTTGACCTTGCCTGCGTTTTCAACTTTACGCAGGAAATGGTTGGACTCCTTTTAGATTAGAGGCAATTTCAATTGATTAGAAT UGGCUUAACCCUACCGCACCAACCGAACUAGAC.....AACGGUGCGGUAGGGGUAAAUUAUCCGCA..UUCGGUGCGGG
.................................................................................................................................................................................................... ........<<<<<<<<<<<<.....................>>>>>>>>>>>>.......................... .
X77708.1 0.00 .TGGCTTGGCATAACGGAGAACAAGAATATGAGGAATTCATCCGAAAGATCAGAAGCGTCCCGGTTGGGCGCTGTCTGACTCTCCCCGCGTTTTCAACTTTACGCAGAAAATGGCTGGATTCCTTTTAAATTAGAGACAATTTGAAATAATTTAAAT UGGCUUAACCCUACUGUACUAACCGAACUAGAC.....AACGGUGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCG-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
............................................................................................................................................................ ........<<<<<<<<<<<<.....................>>>>>>>>>>>>.......................... ............................................
X84981.1 0.00 .ATGTGCGCTCGCTATGTCTATTGGCCTGGCACAACGGGGAGCGCGAATATGAAGAGTTCATCCGCAAAATCAGAAGCGTCCCAGTAGGACGATGTTTGACTCTACCTGCGTTTTCAACCCTACGCAGGAAGTGGTTGGACTCCTTCTAAAGTAGAGACAATTTGATCTAACTTGAAT UGGCUUAACCUUACUGCACUAACCGAACUAGAU.....AACGGUGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCG-
................................................................................................................................................................................. ........<<<<<<<<<<<<.....................>>>>>>>>>>>>..........................
X92886.1 0.00 .T UGGCUUAACCCUACCGCAUGAACCGAACUUGAU.....ACAAGUGCGGUAGGGGUAAAUUCUCCGCA..UUCGGUGCG-
. ........<<<<<<<<<<<.......................>>>>>>>>>>>..........................