Seq ID Score (bits) Sequence
AF029859.2 0.00 .AGAGCACAAUUAGUAGAUUAAAU UGGCUUAACCCUACCGCAUGAACCGAACUUGAU.....AAAAGUGCGGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
....................... ........<<<<<<<<<<.....<......>............>>>>>>>>>>..........................
AF083069.1 0.00 .AGAACACUCAAGAUCAUGUGCGCUCACUGUGUCUAUUGGCCUGGCACAACGGAGAGCACGAAUAUGAGGAGUUCAUCCGUAAAAUUAGAAGCGUCCCAGUCGGACGUUGCUUGACCCUCCCUGCGUUUUCAACCCUGCGCAGGAAAUGGUUGGACUCUUUCUGAAUUAGAGACAAUUUGAAAUAAUUUGAAU UGGCUUAACCCUACUGUACUAACCGAACUAGAU.....AACGGUGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
................................................................................................................................................................................................ ........<<<<<<<<<<.....<......>............>>>>>>>>>>..........................
AF085363.1 0.00 .AUUGGCCUGGCACAAUGGAGAGCACGAGUAUGAGGAGUUCAUCCGCAAAAUCAGGAGCGUCCCGGUCGGACGUUGCUUGUCUCUGCCUGCGUUUUCGACCUUGCGCAGGAAGUGGUUGGACUCUUUUUAAAUUAGAGACAAUUUGAACUAAUUUGAGU UGGCUUAACCCUACUGCAUCAACCGAACUAGAC.....AACGGUGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGGAGGAG
.............................................................................................................................................................. ........<<<<<<<<<<.....<......>............>>>>>>>>>>.......................... .....
AF114383.1 0.00 .CUUUCUAAAUUGGAGACAAUUUGAGAUAAUUUGAAU UGGCUUAACCCUACCGCACUAACCGAACUAGAU.....AACGGUGCGGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
.................................... ........<<<<<<<<<<.....<......>............>>>>>>>>>>..........................
AF114384.1 0.00 .AUUCAUUCGAAAGGUCAGAAGCGUUCCUGUUGGACGCUGUUUGACUCUACCUGCGUUCUCGACACUACGCAGAAAGUGGUUGGAUUCCUUCUAAAUUAGAGACAAUUCGAUAAAAUUUGAAU UGGCUUAACCCUACUGCGCUAACCGAACUAGAC.....AACGGCGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
.......................................................................................................................... ........<<<<<<<<<<.....<......>............>>>>>>>>>>..........................
AF162711.1 0.00 .UGGCUAGACUCUUUUUAGAUUAGAGUACAAUUAUAUAAUUUUAAUUUUAAU UGGCUUAACCCUACCACACUUACCGAACUAGAC.....AACGGUGUGGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
................................................... ........<<<<<<<<<<.....<......>............>>>>>>>>>>..........................
AF230973.1 0.00 .UCAUCCAGACAGAUCAGAUAGCAUCCCAGUUGGGCGCUGUUUGACUUUACCUGCGUUUUCAACCCUGCGCAGGAAAUGGUUGGACUCUUUUUAGAUUAGAGACAAUUUGAAUAAUUUAAAU UGGCUUAACCCUACUGCAUUAACCGAACUAGAC.....AACAAUGCAGUAGGGGUAAAUUUUCCGCG..UUCGGUGCGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
......................................................................................................................... ........<<<<<<<<<<.....<......>............>>>>>>>>>>.......................... ..................................................
AF241359.1 0.00 .CUCUUUUUAAAUUAGAGACAAUUUGAAAUAAUUUGAAU UGGCUUAACCCUACUGUACUAACCGAACUAGAU.....AACGGUACAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
...................................... ........<<<<<<<<<<.....<......>............>>>>>>>>>>..........................
AF268065.1 0.00 .CAAUUAAUCAAUUACAAU UGGCUCAACCCUACCGCAUGAACCGAACUU-AC.....AAAAGUGCGGCAGGGGUAAAUUUUCCGUG..UUCGGUGCGGAAAAAA
.................. ........<<<<.<<<<<.........................>>>>>.>>>>.......................... ......
AF317694.1 0.00 .CCAGUAGGGCGAUGUUUGACUCUACCUGCGUUCUCAACCCUACGCAGGAAGUGGUUGGACUCCUUCUAAAGUAGAGACAAUUUGAUCUAAUUUGAAU UGGCUUAACCCUACUGCACUAACCGAACUAGAU.....AACGGUGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
................................................................................................. ........<<<<<<<<<<.....<......>............>>>>>>>>>>..........................
AF405682.1 0.00 .UCACUGUGCCUAUUGGCAUGGCACAAUGGCGAAGAAGAAUACAAUAAAUUCUUAGCUAAAAUAAGAAGUGUGCCAAUCGGAAGAGCAUUGUUGCUCCCUGAGUACUCAACCUUGUACCGCCGUUGGCUCGACUCAUUU --UAGUAACCCUACCUCAGU---CGAAUUGGAUuggguCAUACUGUUGUAGGGGUAAAUUUUUCUUUaaUUCGGAG---A
.......................................................................................................................................... __......<<<<<<..<<..........<......>.......>>..>>>>>>.......................... .
AF405690.1 0.00 .AUCAGAUGGACUAAGGAUCCUAGGAACACCCAGGAUCAUGUUCGCUCACUGUGCCUAUUGGCCUGGCACAAUGGCGAAGAAGAAUACAACAAAUUUUUAGCUAAAAUCAGAAGCGUGCCAAUCGGCAGAGCUUUACUGCUCCCCGAAUACUCUACGCUGUACCGCCGUUGGCUCGACUCAUUU --UAGUAACCCUACCUCAGU---CGAAUUGGAUuggguCAUACUGUUGUAGGGGUAAAUUUUUCUUUgaUUCGGAG---A
....................................................................................................................................................................................... __......<<<<<<..<<..........<......>.......>>..>>>>>>.......................... .
AJ132961.1 0.00 .AACAAAUUUUUAGCUAAAAUUAGGAGUGUGCCAAUUGGAAGGGCUUUAUUGCUCCCAGAGUACUCAACGUUGUAUCGUCGUUGGCUUGACUCAUUU --UAGUAACCCUACCUCAGU---CGAAUUGGAUuggguCAUACUGAUGUAGGGGUAAAUUUUUCUUUaaUUCGGGG---
................................................................................................ __......<<<<<<.<<<..........<......>.......>>>.>>>>>>..........................
AJ245864.1 0.00 .GCUUGGCUCUUCCUGCGUUCUCAACACUGCGCAGGAAGUGGUUGGACUCCUUCUAGAAGUAGAGCACAAUUUGUAAAUUACAAU UGGCUCAACCCUACCGCAUGAACCGAACUUGAC.....AAAAGUGCAGUAGGGGUAAAUUCUCCCGA..UUCGGUGCGGAGGAGAAAA
.................................................................................... ........<<<<<<.<<<.....<......>............>>>.>>>>>>.......................... .........
AJ276224.1 0.00 .AAUACCCAGGACCAUGUUCGAUCCUUGUGCCUAUUGGCCUGGCACAAUGGCGAGCAAGAAUACGAAGAAUUUGUGUCCAAAAUCAGGAGCGUUCCAGUAGGGCGCUGUUUGACUUUGCCUGCAUUCUCAACUCUACGCAGGAAAUGGCUGGAUUCUUUUUAAAUUAGAGUACAAUUUGGUUAAAUUCCAAU UGGCUUAACCCUACCACACUCACCGAACUAGAU.....AACGGUGUGGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
............................................................................................................................................................................................... ........<<<<<<<<<<.....<......>............>>>>>>>>>>..........................
AY036578.1 0.00 .GUGGUUGGAUUCCUUUUGAACUAGAGACAAUUUGAUACAAUUUGAAU UGGCUUAACCCUACUACACUUACCGAACUAGAC.....AGCGGUGUAGUGGGGGUAAAUUCUCCGCA..UUCGGUGCGG
............................................... ........<<<<<<<<<<.....<......>............>>>>>>>>>>..........................
AY036579.1 0.00 .UGAAU UGGCUUAACCCUACUGCACUAACCGAACUAGAU.....AACGGCGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
..... ........<<<<<<<<<......<......>.............>>>>>>>>>..........................
D00625.1 0.00 .CAAUAAAUUUUUAGCUAAGAUUAGAAGUGUGCCAAUCGGAAGAGCUUUACUGCUCCCUGAGUACUCCACAUUGUACCGCCGUUGGCUCGACUCAUUU --UAGUAACCCUACCUCAGU---CGAAUUGGAUuggguCAUACUGUUGUAGGGGUAAAUUUUUCUUUaaUUCGGAG--G
................................................................................................. __......<<<<<<..<<..........<......>.......>>..>>>>>>..........................
D00627.1 0.00 .CCAAAGAACACCCAAGACCACGUGCGCUCGCUAUGCUUAUUAGCUUGGCACAACGGGGAGCACGAAUAUGAGGAGUUCAUUCGCAAAAUCAGGAGCGUCCCAGUUGGACGUUGUUUGACCCUACCUGCGUUCUCAACCCUACGCAGGAAGUGGUUGGACUCUUUCUAAAUUAGAGACAAUUUGAACUGAUUUGAAU UGGCUCAACCCUACUGUACUAACCGAACUAGAU.....AACGGUGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGGAGG
.................................................................................................................................................................................................... ........<<<<<<<<<<.....<......>............>>>>>>>>>>.......................... ...
D10582.1 0.00 .CCGGUCGGACGUUGCUUGACUCUGCCCGCAUUUUCAACCUUGCGUAGGAAGUGGUUGGACUCUUUUUAAACUAGAGACAAUUUGAACUAAUUUGAAU UGGCUUAACCCUACUGCACUUACCGAACUAGAU.....AACGGUGUAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCG-
................................................................................................. ........<<<<<<<<<<.....<......>............>>>>>>>>>>..........................
K02709.1 0.00 .UAGGCAGGAAGUGGUUGGACUCCUUUUAGAUUAGAGACAAUUGAAACAAUUUAGAU UGGCACAACCCUACUGUGCUAACCGAACCAGAU.....AACGGUACAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCG-
........................................................ ........<<<<<<<<<<.....<......>............>>>>>>>>>>..........................
M16560.1 0.00 .AGGAAGUGGUUGGACUCUUUUUAAAUUAGAGACAAUUUGAACUAAUUUUAAU UGGCUUAACCCUACCGCACUAACCGAACUAGAU.....AACGGUGCAGUGGGGGUAAAUUCUCCGCA..UUCGGUGCG-
.................................................... ........<<<<<<.<<<.....<......>............>>>.>>>>>>..........................
M27727.1 0.00 .UUAGAGGCAAUUUGAAAUAAUUUAAAU UAGCUCAACCCUACUGCACUUACCGAACUAGAU.....AACGGUGUAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
........................... ........<<<<<<<<<<.....<......>............>>>>>>>>>>..........................
M33854.1 0.00 .ACUCUACGCAGGAAGUGGUUGGACUCCUUUUAGAUUAGAGACAAUUUGAAAUAAUUUAGAU UGGCUUAACCCUACUGUGCUAACCGAACCAGAU.....AACGGUACAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
............................................................. ........<<<<<<<<<<.....<......>............>>>>>>>>>>..........................
S76772.1 0.00 .CGAUCCUUGUGCUUGUUAGCCUGGCAUAAUGGAGAGCAAGAGUAUGAAGAGUUGUAUCCAAAAAUCAGGAGCGUUCCAGUGGGGCGCUGUUUGACCCUGCCUGCGUUCUCUACUCUACGCAGGAAGUGGCUAGACGCUUUUUAAAUUAGACACAAUUUGGUUUAAUUCCAAU UGGCUUAACCCUACUGCACUCACCGAAGUAGAU.....AACGGUGUGGUCGGGGUAAAUUCUCCGCA..UUCGGUGCGGA
............................................................................................................................................................................ ........<<<.<<<<<<.....<......>............>>>>>>.>>>.......................... .
U16283.1 0.00 .AAUAAUUUAAAU UAGCUCAACCCUACUGCACUUACCGAACUAGAU.....AAUGGUGUAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCGG
............ ........<<<<<<<<<<.....<......>............>>>>>>>>>>..........................
V01148.1 0.00 .AGAUCCUAGGAACACUCAGGAUCACGUUCGCUCUCUGUGCCUUUUAGCUUGGCACAAUGGCGAAGAAGAAUAUAACAAAUUCCUAGCUAAAAUCAGGAGUGUGCCAAUUGGAAGAGCUUUAUUGCUCCCAGAGUACUCAACAUUGUACCGCCGUUGGCUUGACUCAUUU --UAGUAACCCUACCUCAGU---CGAAUUGGAUuggguCAUACUGCUGUAGGGGUAAAUUUUUCUUUaaUUCGGAG--G
......................................................................................................................................................................... __......<<<<<<..<<..........<......>.......>>..>>>>>>..........................
X00595.1 0.00 .UUGCUCCCGGAGUACUCUACAUUGUACCGCCGUUGGCUCGACUCUUUU --UAGUAACCCUACCUCAGU---CGAAUUGGAUuggguCAUGCUGUUGUAGGGGUAAAUUUUUCUUUaaUUCGGGG---
................................................ __......<<<<<<..<<..........<......>.......>>..>>>>>>..........................
X04468.1 0.00 .AAUGGAGAGGACGAAUACAAUAAAUUUUUAGCUAUGAUCAGAAGCGUGCCAAUUGGAAGGGCUCUAUUGCUCCCUGAGUACUCUACAUUGUACCGCCGUUGGCUCGACUCUUUU --UAGCAACCCUACCUCAGU---CGAAUUGGAUuggguCAUACUGUUGUAGGGGUAAAUUUUUCUUUaaUUCGGAG---
.................................................................................................................. __......<<<<<<..<<..........<......>.......>>..>>>>>>..........................
X05690.1 0.00 .GGUUGGAUUCCUUUUAAAUUAGAGACAAUUUGAAACAAUUUAAAU UGGCUUAACCCUACUGCACUAACCGAACUAGAU.....AACGGUGCAGUAGGGGUAAAUUCUCCGCG..UUCGGUGCGG
............................................. ........<<<<<<<<<<.....<......>............>>>>>>>>>>..........................
X54521.1 0.00 .GAGGAGUUUAUUCGUAAGAUCAGAAGCGUCCGCGUAGGGCGCUGCUUGUCCCUCCCUGCGUUUUCAACGCUGCGCAGGAAGUGGUUGGACUCCUUUUAAAAUUAGAGCACAAUUAGUCAAUCAUAAU UGGCUCAACCCUACCGCAUGAACCGAACUUGAU.....AAAAGUGCGGUAGGGGUAAAUUCUCCGUA..UUCGGUGCGG
............................................................................................................................... ........<<<<<<<<<<.....<......>............>>>>>>>>>>..........................
X67706.1 0.00 .CCAAAAAAUACCCAAGACCAUGUGCGUUCAUUGUGCUUAUUGGCUUGGCACAAUGGAGAACACGAAUAUGAGGAGUUUAUCAAAAAAAUCAGAAGCGUCCCAGUUGGGCGUUGCUUGACCUUGCCUGCGUUUUCAACUUUACGCAGGAAAUGGUUGGACUCCUUUUAGAUUAGAGGCAAUUUCAAUUGAUUAGAAU UGGCUUAACCCUACCGCACCAACCGAACUAGAC.....AACGGUGCGGUAGGGGUAAAUUAUCCGCA..UUCGGUGCGGG
.................................................................................................................................................................................................... ........<<<<<<<<<<.....<......>............>>>>>>>>>>.......................... .
X77708.1 0.00 .UGGCUUGGCAUAACGGAGAACAAGAAUAUGAGGAAUUCAUCCGAAAGAUCAGAAGCGUCCCGGUUGGGCGCUGUCUGACUCUCCCCGCGUUUUCAACUUUACGCAGAAAAUGGCUGGAUUCCUUUUAAAUUAGAGACAAUUUGAAAUAAUUUAAAU UGGCUUAACCCUACUGUACUAACCGAACUAGAC.....AACGGUGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCG-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
............................................................................................................................................................ ........<<<<<<<<<<.....<......>............>>>>>>>>>>.......................... ............................................
X84981.1 0.00 .AUGUGCGCUCGCUAUGUCUAUUGGCCUGGCACAACGGGGAGCGCGAAUAUGAAGAGUUCAUCCGCAAAAUCAGAAGCGUCCCAGUAGGACGAUGUUUGACUCUACCUGCGUUUUCAACCCUACGCAGGAAGUGGUUGGACUCCUUCUAAAGUAGAGACAAUUUGAUCUAACUUGAAU UGGCUUAACCUUACUGCACUAACCGAACUAGAU.....AACGGUGCAGUAGGGGUAAAUUCUCCGCA..UUCGGUGCG-
................................................................................................................................................................................. ........<<<<<<<<<<.....<......>............>>>>>>>>>>..........................
X92886.1 0.00 .U UGGCUUAACCCUACCGCAUGAACCGAACUUGAU.....ACAAGUGCGGUAGGGGUAAAUUCUCCGCA..UUCGGUGCG-
. ........<<<<<<<<<<.....<......>............>>>>>>>>>>..........................