Seq ID Score (bits) Sequence
AF029859.2 0.00 .GCCCACUAUUGCAGAAAGUACGCACCUCUGUAUGCCGCCGAAGCAAAAAGAGUGUUCUCGUUGGAGAAAAA GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUACUUCUCCAUGGCAGCCCAGGAGCGGGGAAAUCCGUGGCUACAAACCUAAUUGGUAGAUCCCUCGCGGAGAAACUUAACAGCUCUGUGUACUCGUUACCACCAGACCCAGAUCAUUUUGAUGGAUACAAACAACAA
.................................<<....>..<<..................<<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<....... .........<<.<...>.>>..>..>>...>>..>..............................................................................................
AF039205.1 0.00 .UUGCUACCAUUGAACAGAGCGCACCGUCCCAGAGUGACCAGGAGCAACUCUUCUCAAACGUCCAAUACUUUGCUCACUACUGCAGGAAGUACGCGCCCUUGUACGCAGCUGAAGCCAAAAGGGUGUUCUCUCUUGAAAAGAA AAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCUUGCUACUACAUGGCAGCCCCGGAGCAGGGAAAUCAGUUGCUACCAGCCUCAUUGGGCGAUCACUAG
........................................................................................................<<....>..<<..................<<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<....... .........<<.<...>.>>..>..>>...>>..>.......................
AF081485.1 0.00 .AGGCUUAAACAGCUUCCCUUAUUGGAAAGUCAGAUCGCCACAAUCGAGCAGAGUGCACCGUCCCAGAGUGACCAGGAGCAAUUGUUCUCCAAUGUCCAAUACUUUGCACACUAUUGCAGAAAGUACGCUCCCCUCUAUGCAGCUGAGGCAAAGAGGGUGUUCUCCCUUGAAAAGAA GAUGAGCAAUUACAUACAAUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGUUCCUACACGGGAGCCCUGGCGCCGGCAAG
...........................................................................................................................................<....>.......<........>.......<<..... .........>>.<<<<<..<<<<<...<.......>..>>>>>...>>>>>..<....... .........<<.<...>.>>..>.
AF083069.1 0.00 .CUGGAGAAGAA GAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUGCUCCUACACGGGAGUCCUGGCGCCGGCAAAUCGGUAGCAACAAAUCUAAUUGGAAGAUCACUAGCUGAAAAGCUUAACAGCUCAGUGUACUCACUACCACCAGACCCAGAUCACUUCGAUGGCUAUAAGCAACAGGCCGUGGUGAUCAUGGAUGAUCUGUGUCAGAAUCCUGAUGGGAAGGAUGUUUCCUUGUUC
...<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........><<.<...>.>>..>..>...................................................................................................................................................................
AF085363.1 0.00 .GUUCUCCCUUGAAAAGAA GAUGAGCAAUUACAUACAAUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUCCUACACGGGAGCCCUGGCGCCGGCAAGUCGGUAGCAACGAACCUAAUUGGAAGGUCACUUGCCGAGAAACUCAAUAGCUCAGUGUAUUCACUACCACCAGACCCAGAUCACUUCGAUGGCUAUAAACAGCAAGCCGUGGUGAUCAUGGACGAUCUAUGCCAAAACCCAGAUGGAAAAGAUGUCUC
.........<<<<..... .........>>.<<<<<..<<<<<...<.......>..>>>>>...>>>>>..<....... .........<<.<...>.>>..>..>>...........................................................................................................................................................
AF114383.1 0.00 .CUUCUCCCUUGAAAAGAA AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUGCUCCUACACGGGAGUCCUGGUGCUGGCAAGUCAGUAGCAACAAAUCUAAUUGGAAGGUCACUUGCUGAGAAACUCAACAGUUCAGUGUACUCACUACCACCGGACCCAGAUCACUUCGAUGGCUAUAAACAGCAGGCCGUGGUGAUCAUGGACGAUCUAUGCCAGAACCCCGAUGGGAAGGAUGUGUC
.........<<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........><<.<...>.>>..>..>>...........................................................................................................................................................
AF119795.2 0.00 .ACGCCCUAGAAAAGAG AAUGAAUAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGCCUAAUCAUCAGAGGCUCGCCUGGUACUGGGAAGUCCUUGGCAACAGGGAUUAUUGCUAGAGCCAUAGCAGACAAGUACCACUCCAGUGUGUAUUCACUUACCUCAGACCCAGACCACUUUGACGGAUACCAACAACAGAUCGUCACUGCUAUGGACGACCUAUGCCAGAAUCCAGACGGCAAAGACAUGUCAU
........<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........><<.<...>.>>..>..>..............................................................................................................................................................
AF162711.1 0.00 .UGCUGAGGCAAAAAGGGUCUUUUCCUUAGAGAAGAA AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUACUCCUACAUGGGAGCCCUGGUGCCGGAAAGUCCGUGGCAACUAACUUGAUUGGGCGGUCACUUGCAGAAAAACUCAACAGCUCAGUGUACUCGUUGCCACCAGACCCUGAUCACUUUGAUGGCUACAAACAGCAAGCUGUAGUGAUCAUGGACGACCUGUGCCAGAACCC
.......<<...<........>......<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<....... .........<<.<...>.>>..>..>....>>....................................................................................................................................
AF177911.1 0.00 .GAAGCUAUGUUUGGUAAUGUGUCAUAUUUAGCCCACUUCUGCCGCAAGUUUCAGCCACUCUACGCGACUGAAGCCAAAAGAGUCUAUGCCCUAGAGAAAAG GAUGAACAACUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCCGUAUGUUUGAUCAUUAGAGGCUCUCCAGGAACAGGCAAGUCACUUGCUACGGGCAUCAUAGCUAGAGCUAUUGCUGACAAAUACCAUUCUAGCGUUUACUCACUCCCUCCAGAC
...............................................................<<....>..<<...<........>......<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<....... .........<<.<...>.>>..>..>....>>..>................................................................
AF201894.1 0.00 .GUGCUGAUUUUGUGAAUAGACUGAAGCAAUUGCCACUGCUGGAGGCACAGAUGGCCACACUUGAACACGCCGCUCCAAAUCAGGAGAAACAAGAACGACUUUUUACAAAUGUACAAUAUUUUGCAACAUAUUGCAGAAAAUAUGCUCCACUGUAUGCCAGUGAAGCUAGGCGUGUCUUCCAGAUGGAAAAGAA GAUGAAUAACUACAUACAGUUCAAGAGCAAAUCAAGGAUUGAACCCGUAUGUUUAUUAAUCCAUGGGA
............................................................................................................................................................<....>.......<........>.......<...... ..........>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>.......... .......
AF231763.1 0.00 .UAGAAAGUCAGAUCGCCACAAUCGAGCAGAGCGCGCCAUCCCAAAGUGACCAGGAACAAUUAUUUUCCAAUGUCCAAUACUUUGCCCACUAUUGCAGAAAGUACGCUCCCCUCUACGCAGCUGAAGCAAAGAGGGUGUUCUCCCUUGAGAAGAA GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUCCUGCACGGGAGCCCUGGUGCCGGCAAGUCGGUGGCAACAAACUUAAUUG
....................................................................................................................<<....>..<<...<........>.....<<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........><<.<...>.>>..>..>>...>>..>...........
AF241359.1 0.00 .CAGGAGCAAUUGUUCUUGAAUAUCCAAUACUUUGCUCACUAUUGCCGAAAAUAUGCACCCCUCUAUGCAUCAGAGGCAAAGAGAGUGUUCUCCCUUGAGAAGAG GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUCUGCUCUUACAUGGGAGUCCCGGUGCAGGCAAGUCAGUGGCAACAAACCUGAUCGGGAGAUCACUCGCUGAAAAGCUUAACAGCUCAGUGUAUUCACUACCCCCA
..................................................................<<....>..<<...<........>.....<<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........><<.<...>.>>..>..>>...>>..>.............................................................
AF268065.1 0.00 .GAACAACUAUUCUCAAAUGUGCAGUAUUUUGCCCAUUACUGUCGGAAGUAUGCGCCACUGUAUGCUGCUGAAGCAAAGAGGGUGUUCUCUCUUGAAAAGAA GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUCUCUUGCUCCAUGGUAGCCCAGGUGCUGGGAAGUCAGUGGCAACGAACUUGAUUGGGCGCUCGCUCGCCGAAAAACUCAACAGCUCGGUAUACUCACUACCACCAGAU
...............................................................<<....>..<<...<........>.....<<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<....... .........<<.<...>.>>..>..>>...>>..>................................................................
AF302996.1 0.00 .GCCUCACAAGAGGACCUUGAGGUCAUGUUUGGGAAUGUGUCGUAUCUAGCCCACUUCUGUCGCAAGUUCCAACCGCUAUAUGCCACAGAAGCUAAAAGAGUUUAUGCCCUGGAGAAAAG AAUGAAUUAUUACAUGCAGUUCAAGAGCAAACACCGAAUUGAACCUGUAUGUCUUAUUAUUAGGGGCUCACCAGGCACUGGGAAGUCUCUAGCCACUGGCAUCAUUGCUCGAGCAAUCGCUGAUAAGUACCACUCCAGCGUG
.................................................................................<<....>..<<...<........>.....<<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........><<.<...>.>>..>..>>...>>..>..............................................
AF304459.1 0.00 .AAAGUCGAGUUUCUAAACAAUCUAAAGCAACUCCCCUUAUUGGAGAACCAAAUUUCUAAUCUCGAACAGUCAGCAGCUUCGCAGGAGGACCUUGAGGCGAUGUUUGGCAACGUGUCUUACCUGGCCCACUUCUGCCGCAAAUUCCAACCCCUCUAUGCCACGGAAGCAAAGAGGGUGUACGCCCUAGAAAAGAG AAUGAAUAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGCCUAAUUAUCAGAGGC
.............................................................................................................................................................<....>.......<........>.......<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>.......... ......
AF311938.1 0.00 .AACAGAUUAAAACAAUUGCCACUAUUGGAGAGUCAGAUUGCUACCAUUGAGCAAAGCGCACCUUCACAAAGUGACCAAGAACAGUUGUUCUCUAAUGUCCAAUACUUUGCCCACUACUGCAGAAAGUAUGCCCCCUUGUAUGCUGCUGAGGCAAAAAGGGUCUUUUCCUUAGAGAAGAA AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUACUGCUACAUGGGAGCCCUGGUGCCGGA
..............................................................................................................................................<....>.......<........>.......<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>.......... .........<<.<...>.>>.
AF311939.1 0.00 .UCUUAAACAGGCUAAAGCAACUGCCCUUGUUGGAAAGUCAAAUAGCCACCAUAGAACAAAGCGCACCCUCACAAAGUGACCAGGAACAAUUGUUCUCUAAUGUCCAGUAUUUUGCCCACUACUGUAGAAAGUACGCCCCCCUGUACGCUGCUGAAGCAAAAAGGGUCUUCUCCUUAGAGAAGAA AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCCUAUUGCUACACGGGAGCCCUGGUG
...................................................................................................................................................<....>........................<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>.......... ................
AF316321.2 0.00 .UUUCUGUCGCAAGUUCCAACCAUUAUACGCCACGGAGGCCAAGCGAGUCUAUGUUCUAGAGAAGAG AAUGAACAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGUCUCAUCAUUAGAGGCUCACCAGGCACUGGAAAGUCCCUUGCGACCGGCAUCAUUGCCCGGGCCAUAGCAGACAAGUACCACUCUAGUGUGUACUCACUCCCACCGGAUCCUGACCAUUUUGACGGGUACAAACAGCAAGUGGU
............................<<....>..<<...<........>......<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........><<.<...>.>>..>..>....>>..>...................................................................................................
AF405666.1 0.00 .AGAGGCUAAAAGGAUACAGAAACUAGAACAUAC AAUAAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUCUGUUGGUACACGGGAGCCCUGGCACUGGAAAGUCUGUCGCCACCAACUUAAUUGCUAGAGCAAUUGCAGAGAGGGAGAACACUUCAACAUAUUCACUACCUCCCGAUCCUUCCCACUUCGAUGGAUAUAAACAACAAGGGGUAGUAAUUAUGGAUGACCUAAAUCAAAACCCAGA
....<<..................<<<...... ..........>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<....... .........<<.<...>.>>..>..>>...>>.......................................................................................................................................
AF405669.1 0.00 .CCAUUCAAUCAAAAAAAUUUGCACCACUGUACGCACUUGAGGCAAAGAGAAUACAAAAAUUAGAACAUAC CAUCAAUAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUAGUGCACGGUAGCCCAGGCACGGGGAAGUCAGUUGCCACCAAUCUGAUUGCUAGAGCUAUUGCAGAGAAAGAGAACACCUCUACCUACUCUCUACCCCCAGACCCCUCACACUUUGAUGGUUACAAGCAGCAGG
................................<<....>..<<...................<<...... ..........>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........><<.<...>.>>..>..>....>>..>...............................................................................................
AF405682.1 0.00 .UAUGCACUUGAGGCAAAGAGAAUACAAAAAUUGGAACACAC CAUUAAUAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUAGUACACGGCAGCCCAGGUACGGGGAAGUCAGUUGCCACCAAUCUGAUUGCCAGGGCCAUUGCUGAGAAAGAGAACACCUCCACUUACUCGCUACCUCCAGACCCCUCACACUUUGAUGGUUACAAACAACAGGGUGUGGUGAUUAUGGAUGACCUCAACCAG
...<<....>..<<...................<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<....... .........<<.<...>.>>..>..>....>>..>............................................................................................................................
AF462418.1 0.00 .CUUAUUCAACAAUGUGCGGUGGCUAUCUAUCCAGUCCAAGAGGUUUGCACCACUAUAUGCACAUGAAGCUAAAAGGAUUCAAAAGCUGGAGCAUAC CAUAAAUAAUUACGUACAGUUCAAGAGCAAGCACCGUAUUGAGCCAGUAUGUUUGUUAGUGCAUGGUAGUCCAGGGACAGGAAAAUCAGUUGCAACCAAUCUAAUUGCUAGAGCGAUAGCCGAGAAAGAGAACACCUCCACAUACUCACUACCACCUGACCCAUC
..........................................................<<....>..<<...................<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........><<.<...>.>>..>..>....>>..>.....................................................................
AF462419.1 0.00 .AAAAGGAUUCAAAAGCUGGAGCAUAC CAUAAAUAAUUACGUACAGUUCAAGAGCAAGCACCGUAUUGAGCCAGUAUGUUUGUUAGUACAUGGCAGUCCAGGGACAGGAAAAUCAGUUGCAACCAAUCUAAUUGCUAGAGCAAUAGCCGAGAAAGAGAACACCUCCACAUACUCACUGCCACCUGAUCCGUCUCACUUUGAUGGCUACAAGCAACAGGGUGUGGUUAUUAUGGAUGACCUAAACCAAAAUCCAGACGGAGCA
..................<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........><<.<...>.>>..>..>....................................................................................................................................................
AF504533.1 0.00 .ACCAUCCCAGAGUGAUCAGGAGCAGCUCUUUUCAAACGUCCAAUACUUUGCACACUACUGCAGGAAGUACGCACCGCUCUACGCUGCAGAAGCUAAGAGAGUGUUCUCCCUCGAGAAAAA GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUACUCCUGCAUGGAAGCCCUGGUGCAGGGAAGUCGGUCGCCACCAACCUAAUCGGGCGCUCACUGGCCGAGAAGCUAAAUAGUUCAGU
..................................................................................<<....>..<<...<........>.....<<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........><<.<...>.>>..>..>>...>>..>.............................................
AF504534.1 0.00 .AGUAUUUUGCACAUUACUGCAGGAAGUACGCCCCUUUGUACGCUGCUGAAGCUAAGAGAGUUUUCUCCCUCGAGAAGAA GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUUUAUUGCUGCAUGGAAGUCCUGGAGCUGGGAAAUCGGUCGCCACCAACCUAAUCGGGCGCUCACUUGCCGAGAAGCUAAACAGUUCGGUGUACUCCCUGCCACCGGACCCCGACCAUUUCGAUGGGUACA
.........................................<<....>..<<...<........>.....<<<<..... .........>>.<<.<<.<<<<<<...<.......>..>>>>>>..>>.>>..<......< ........><<.<...>.>>..>..>>...>>..>......................................................................................
AF504536.1 0.00 .AAGCAGUUACCUUUACUAGAAAGCCAGAUUGCUACCAUUGAACAGAGUGCACCCUCCCAGAGUGACCAAGAACAGCUCUUUUCAAACGUGCAGUAUUUUGCACAUUACUGCAGGAAGUAUGCCCCUUUGUACGCUGCUGAAGCUAAGAGAGUUUUCUCCCUCGAAAAGAA GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUUUAUUGCUGCAUGGAAGUCCUGGAGCUGGGAAAUCGGUC
.....................................................................................................................................<....>.......<........>.....<<<<..... .........>>.<<.<<.<<<<<<...<.......>..>>>>>>..>>.>>..<......< ........><<.<...>.>>..>..>>...
AJ132960.1 0.00 .AGGAAAUUCUAUUCAAUAAUGUCAGAUGGUUAUCCAUCCAGUCCAAGAGAUUUGCCCCUCUUUACGCAGUGGAAGCCAAAAGAAUACAGAAGCUAGAGCAUAC CAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGCUAGUGCAUGGCAGCCCCGGAACAGGCAAAUCCGUAGCAACCAAUCUGAUCGCUAGAGCCAUAGCUGAAAGAGAAAACACGUCUACGUAUUCGCUACCCCCGG
.................................................................<<....>..<<...................<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........><<.<...>.>>..>..>....>>..>..............................................................
AJ132961.1 0.00 .GCUGGAAAAUCAAAUUUCAACUAUACACCAAUCAUGUCCUAGUCAGGAACACCAGGAAGUUCUGUUCAAUAACGUCAGAUGGUUAUCCAUCCAGUCCAAGAGAUUUGCCCCUCUCUACGCAAUGGAAGCCAAAAGAAUACAGAAGCUAGAACACAC UAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGCUUGCUAGUGCAUGGCAGCCCCGGAACAGGCAAAUCCGUAGCAACCAAUUUGAU
......................................................................................................................<<....>..<<...................<<...... ..........>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........><<.<...>.>>..>..>....>>..>.........
AJ276224.1 0.00 .AGUACUUUGCACAUUAUUGCAGAAAGUAUGCCCCCCUGUAUGCUGCCGAAGCAAAGAGAGUGUUCUCCCUAGAAAAGAA GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUCUUUUGCUCCACGGGAGCCCCGGUGCUGGUAAGUCAGUGGCAACUAACUUGAUUGGGAGAUCACUUGCUGAGAAACUCAACAGUUCUGUGUACUCACUACCACCAGACCCCGACCAUUUUGACGGAUACA
.........................................<<....>..<<...<........>......<<...... ..........>.<<.<<.<<<<<<...<.......>..>>>>>>..>>.>>..<....... .........<<.<...>.>>..>..>....>>..>......................................................................................
AJ293918.1 0.00 .AACUAUCCACCAGUCCUGUCCAAGUCAGGAACACCAGGAGAUACUCUUCAACAACGUCAGGUGGUUGUCUAUACAAUCAAAAAAGUUCGCCCCUCUCUACGCCGUGGAAGCCAAAAGAAUCCAGAAAUUAGAGCACAC AAUUAACAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGCUUGUUAGUGCAUGGUAGUCCAGGGACGGGCAAAUCGGUUGCCACAAAUUUGAUUGCCAGAGCUAUUGCUGA
....................................................................................................<<....>..<<...................<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........><<.<...>.>>..>..>....>>..>...........................
AJ295172.1 0.00 .UGUUCUCCCUUGAAAAGAA ACUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCCGUAUGUUUGCUCCUACAUGGCAGCCCGGGUGCUGGGAAGUCUGUGGCUACUAGCUUAAUUGGCAGAUCCCUUGCAGAAAAACUCAAUAGCUCGGUGUACUCCCUACCACCAGACCCAGACCACUUUGAUGGAUAUAAGCAGCAAGCGGUGGUGAUUAUGGAUGACCUGUGUCAGAACCCGGAUGGAAAGGACGUGU
...........<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<....... .........<<.<...>.>>..>..>...........................................................................................................................................................
AJ295214.1 0.00 .GCCCCUAUUGGAAAGCCAAAUCGCCACCAUUGAGCAGAGUGCACCCUCACAGAGCGAUCAGGAACAAUUAUUCUCAAAUGUCCAGUACUUUGCACAUUAUUGCAGGAAGUACGCCCCCCUGUAUGCCGCUGAGGCAAAAAGGGUGUUUUCCUUAGAGAAGAA GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUCUCUUGCUUC
.............................................................................................................................<....>.......<........>.......<<..... .........>>.<<.<<.<<<<<<...<.......>..>>>>>>..>>.>>.......... .
AJ416942.1 0.00 .UUCAAUAAUGUCAGAUGGUUAUCCAUCCAGUCUAAGAGGUUUGCCCCUCUUUAUGCAGUGGAAGCCAAAAGAAUACAGAAACUAGAGCAUAC CAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGCUAGUACAUGGCAGCCCCGGAACAGGUAAAUCUGUAGCAACCAACCUGAUUGCUAGAGCCAUAGCUGAAAGAGAAAACACGUCCACGUACUCGCUACCCCCGGAUCCAUCACAC
......................................................<<....>..<<..................<<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<....... .........<<.<...>.>>..>..>>...>>..>.........................................................................
AY036578.1 0.00 .UCCAAUGUUCAGUAUUUUGCACACUAUUGCAGGAAGUAUGCCCCUUUAUACGCCGCCGAGGCUAAGAGAGUGUUUACCUUGGAGAAGAA AAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGCAUUGAACCUGUCUGUCUUCUGCUCCACGGGAGUCCUGGUGCUGGUAAGUCCGUGGCGACCAAUCUGAUCGGGCGUUCAUUGGCUGAAAAACUCAAUAGCUCAGUGUACUCGUUACCACCUGACCCAGAUCAUUUC
...................................................<<....>..<<...<........>.....<<<<..... .........>>.<<.<<.<<<<<<...<.......>..>>>>>>..>>.>>..<....... .........<<.<...>.>>..>..>>...>>..>............................................................................
AY036579.1 0.00 .CAAAGUGAUCAAGAACAAUUGUUUUCUAAUGUACAGUACUUCGCUCACUACUGCAGGAAGUAUGCGCCUUUGUAUGCAGCUGAGGCAAAAAGAGUGUUUUCCCUUGAGAAGAA GAUGAGUAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCCGUAUGUCUGCUCUUGCACGGGAGCCCUGGUGCUGGUAAGUCAGUGGCAACAAACUUAAUUGGUAGAUCACUUGCUGAAAAACUCAACAGCUCAGUGUAUUCA
...........................................................................<<....>..<<...<........>.....<<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........><<.<...>.>>..>..>>...>>..>....................................................
AY056701.1 0.00 .GUUAUCCAUAUCAAAGAGGUUUGCACCAUUGUACGCAGUGGAGGCUAAAAGAAUCCAGAAGUUGGAACACGG AAUUAAUAAUUACAUACAGUUCAAGAGCAAACACCGGAUUGAACCAGUAUGUCUAUUAGUGCAUGGUAGCCCAGGGACAACAAAAUCAGUUGCAACAAACCUGAUUGCCAGAGCAAUAGCAGAAAAGGAAAAUACUUCCAUCUCCCUUCCACCAGACCCUUCUCACUUUGAUGGCUACAAACAGCAAGG
..................................<<....>..<<...................<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........>...<...>.....>..>....>>..>.............................................................................................
D00435.1 0.00 .CACUUGAAAAGAA GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUCUCUUGCUCCAUGGCAGCCCAGGCGCUGGGAAGUCUGUGGCAACGAACUUGAUUGGGCGCUCGCUCGCUGAGAAACUCAACAGCUCGGUGUACUCACUACCACCAGAUCCAGACCAUUUCGAUGGUUACAAACAGCAAGCCGUUGUCAUCAUGGACGACUUGUGCCAGAACCCGGACGGUAAAGAUGUGUCCUUGU
.....<<<..... .........>>.<<.<<.<<<<<<...<.......>..>>>>>>..>>.>>..<....... .........<<.<...>.>>..>..>.................................................................................................................................................................
D00538.1 0.00 .GUGGAGGCACGCCGGAUUAGCAAAAUGGAGAGCAC AAUAAACAAUUAUAUACAGUUCAAGAGCAAACACCGUAUUGAGCCAGUAUGUAUGCUCGUUCAUGGGUCACCAGGGACGGGUAAGGGUAUAGCUAGCUCAUUGAUAGGUAGAGCAAUAGCAGAGAGGGAAACCACAUCGGUCUACUCAGUGCCACUGGCCCCAUCUCACUUUGAUGGCUAUAAACAACAAGGGUAUGAUAUGGACGACCUAAACCAAAACCCCGAU
......<<..................<.<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........><<.<...>.>>..>...>...>>.....................................................................................................................................
D00625.1 0.00 .GGAGAUUUGCCCCGCUCUAUGCGGUCGAGGCUAAGAGAAUACAAAAGUUAGAGCACAC GAUUAACAACUACGUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUGGUGCACGGUAGCCCAGGCACGGGCAAGUCAGUUGCCACCAAUUUAAUUGCCAGAGCAAUAGCAGAGAAGGAGAACACCUCCACAUACUCACUACCACCAGAUCCCUCCCAUUUCGAUGGGUACAAGCAACAAGGUGUGGUGAUCA
....................<<....>..<<...................<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........><<.<...>.>>..>..>....>>..>...........................................................................................................
D00627.1 0.00 .AAACAGCUUCCCCUAUUAGAGAGUCAGAUUGCCACCAUCGAGCAGAGUGCACCAUCCCAAAGCGACCAAGAGCAAUUGUUUUCCAAUGUCCAGUACUUUGCACACUAUUGCAGAAAGUAUGCCCCCCUCUACGCAGCAGAGGCAAAGAGGGUGUUCUCCCUUGAGAAAAA GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUGCUCCUACAUGGGAGUCCAGGUGCCGGCAAGUCGGUG
.....................................................................................................................................<....>.......<........>.....<<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........><<.<...>.>>..>..>>...
D00820.1 0.00 .CAAAUAGUGAGCRACAACAGGCCCUGUUUAAUAAUGUGCAAUACUAUUCACACUACUGCAAAAAAUACGCUCCUUUGUAUGCACUAGAAGCUAAGAGGGUUUCUGCCUUAGAAAGGAA AAUUAACAACUACAUACAGUUCAAGUCCAAAUCUCGCAUUGAACCAGUAUGUUUGAUAAUACAUGGAUCUCCAGGCACUGGGAAGUCAGUGGCAUCUAACCUCAUUGCCAGAGCUAUUACAGAAAAACUGGGUGGGGAUUCUU
................................................................................<<....>..<<...<........>......<<...... ..........>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........><<.<...>.>>..>..>....>>..>...............................................
D10582.1 0.00 .UAUUCUCCCUUGAGAAGAA GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUCUACUUCUACACGGGAGCCCUGGCGCCGGUAAGUCGGUAGCAACAAAUCUAAUCGGAAGAUCACUCGCUGAGAAACUUAACAGCUCAGUGUACACACUACCACCAGACCCAGAUCACUUUGACGGAUAUAAACAGCAGGCCGUGGUGAUCGUGGACGACUUGUGCCAGAAUCCUGAUGGAAAAGAUGUCU
..........<<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<....... .........<<.<...>.>>..>..>>..........................................................................................................................................................
D90457.1 0.00 .AUCCUGUUUAAUAAUGUACGGUGGCUUGCAAUACAGUCGCGUAGGUUUGCACCAUUGUACGCAGUUGAGGCUAAAAGAAUUUCUAAAUUGGAAAACAC CAUUAACAACUAUAUCCAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUAUGUUGAUACAUGGCUCCCCAGGAACAGGAAAAUCCAUUGCCACAUCAUUAAUUGGCAGAGCGAUUGCAGAAAAGGAAAACACCUCGACAUACUCACUUCCACCUGAUCCC
............................................................<<....>..<<...<........>.....<<<...... ..........>.<<<.<.<<<<<<...<.......>..>>>>>>..>.>>>..<....... .........<<.<...>.>>..>..>>...>>..>...................................................................
K01392.1 0.00 .AAGUUGGAACACAC CAUUAAUAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAGCCAGUAUGUUUGUUAGUGCAUGGGAGCCCAGGUACAGGAAAAUCAGUUGCGACUAACCUAAUUGCUAGAGCCAUAGCUGAGAAAGAGAACACCUCCACCUACUCGCUACCACCGGACCCGUCUCACUUUGAUGGAUACAAACAACAAGGUGUGGUUAUCAUGGACGACCUAAACCAAAACCCGGAUGGGGCAGAUAUGAAGCUC
......<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........><<.<...>.>>..>..>................................................................................................................................................................
M16560.1 0.00 .CCUUCUCAGAGUGAUCAAGAGCAAUUGUUUUCUAAUGUUCAGUACUUUGCACAUUACUGCAGGAAAUACGCACCCCUGUAUGCGGCCGAAGCAAAAAGGGUGUUCUCCCUUGAGAAGAA AAUGAGUAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCUUGCUCUUGCACGGGAGUCCUGGUGCAGGGAAGUCAGUUGCCACUAACCUGAUUGGGCGCUCACUCGCGGAGAAGCUUAAUAGCUCUGUG
.................................................................................<<....>..<<..................<<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........><<.<...>.>>..>..>>...>>..>..............................................
U05876.1 0.00 .GUCUACGCCCUGGAGAAAAG GAUGAAUAACUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGUCUCAUCAUCAGGGGCUCACCAGGUACUGGGAAAUCUUUGGCAACCGGUAUCAUUGCCCGGGCAAUAGCCGACAAGUACCACUCCAGUGUGUAUUCACUUCCCCCAGACCCAGAUCACUUUGAUGGGUACAAACAACAAGUAGUUACAGUUAUGGAUGAUUUGUGUCAAAAUCCUGAUGGUAAGGAUAUG
...........<<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<....... .........<<.<...>.>>..>..>>.........................................................................................................................................................
U22521.1 0.00 .GCUAUGUUUGGUAAUGUGAUAUAUCUGGCUCACUUUUGCCGCAAAUUCCAACCACUCUACGCAACUGAGGCCAAGAGAGUCUACGCUUUAGAGAAAAG GAUGAAUAACUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGCUUGAUCAUCAGAGGUUCCCCCGGAACGGGCAAAUCGCUCGCCACAGGCAUUAUAGCUAGAGCCAUUGCUGACAAGUAUCGCUCUAGUGUAUACUCACUCCCCCCAGACCCA
............................................................<<....>..<<...<........>......<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<....... .........<<.<...>.>>..>..>....>>..>...................................................................
U22522.1 0.00 .AACCAAUUUGAAGCAGUUCCCCCUGUUAGAGAAUCAGAUCACACAUUUAGAACAAUCCGCUGCCUCACAAGAAGAUCUUGAAGCAAUGUUUGGGAAUGUGUCAUACCUCGCCCAUUUCUGUCGCAAGUUUCAACCAUUGUACGCCACAGAAGCUAAGCGAGUCUAUGUUCUAGAGAAGAG AAUGAAUAAUUACAUGCAGUUCAAGAGCACACACCGUAUUGAACCUGUAUGUCUCAUCAUCAGGGGCUCACCAGGCACUGG
...............................................................................................................................................<....>.......<........>.......<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>.......... .........<<.<...>.>>
U57056.1 0.00 .CAAAUUGCCACAAUCGAGCAAAGUGCACCGUCACAGAGUGACCAGGAGCAAUUGUUUUCCAAUGUCCAAUACUUUGCUCACUAUUGCAGAAAGUAUGCUCCCCUUUAUGCAUCAGAGGCAAAGAGAGUGUUCUCCCUUGAGAAGAA GAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUCUGCUCCUGCAUGGGAGUCCCGGUGCAGGUAAGUCAGUUGCAACAAAUCUGAUCGGAAGAUCA
............................................................................................................<<....>..<<...<........>.....<<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........><<.<...>.>>..>..>>...>>..>...................
V01148.1 0.00 .ACUAGAAAUGCUGGAAAACCAAAUCUCAACUAUACACCAAUCAUGCCCUAGUCAGGAACACCAGGAAAUUCUAUUCAAUAAUGUCAGAUGGUUAUCCAUCCAGUCUAAGAGGUUUGCCCCUCUUUACGCAGUGGAAGCCAAAAGAAUACAGAAACUAGAGCAUAC UAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGCUAGUACAUGGCAGCCCCGGAACAGGUAAAUCUGUAGCAAC
...............................................................................................................................<<....>..<<..................<<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<....... .........<<.<...>.>>..>..>>...>>..>
X04468.1 0.00 .GGGACAAAUUGGAAUUUGUUACCAAGUUGAAACAGUUAGAGAUGUUGGAGAACCAAAUUGCAACCAUCCACCAGUCAUGCCCCAGCCAGGAACACCAGGAGAUUCUGUUCAACAAUGUGAGGUGGUUGUCCAUUCAGUCAAAAAGGUUCGCCCCACUCUACGCAUUAGAGGCAAAGAGAAUACAGAAGUUGGAACACAC GAUUAACAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUAGUAC
..................................................................................................................................................................<....>........................<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>.......... .
X05690.1 0.00 .AAAGUGCACCCUCUCAAAGUGACCAGGAACAGCUGUUCUCAAAUGUCCAGUACUUCGCUCACUAUUGCAGAAAGUACGCACCGCUCUACGCUGCAGAAGCCAAGAGGGUGUUUUCCCUUGAAAAAAA AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCUUGCUUUUGCAUGGUAGCCCAGGAGCGGGGAAGUCAGUUGCUACCAACUUAAUUGGGCGGUCAUUAGCUGAAAAGUUAAACA
.........................................................................................<<....>..<<...<........>.....<<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........><<.<...>.>>..>..>>...>>..>......................................
X67706.1 0.00 .ACUGUAUGCUGCUGAGGCAAAAAGGGUAUUUUCCCUUGAAAAGAA AAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUUCUGCACGGAAGUCCGGGUGCUGGGAAAUCAGUCGCCACCAACUUGAUUGGGCGCUCGUUGGCUGAAAAACUAAACAGCUCAGUGUAUUCCUUACCACCGGACCCAGAUCACUUCGACGGUUACAAACAGCAAGCUGUCGUAAUCAUGGACGACUUGUG
.......<<....>..<<...<........>.....<<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........><<.<...>.>>..>..>>...>>..>........................................................................................................................
X84981.1 0.00 .CAAACAACUCCCAUUAUUAGAGAGUCAAAUUGCCACGAUUGAACAGAGCGCACCAUCUCAGGGUGACCAGGAACAACUGUUUUCCAACAUCCAAUACUUCGCCCAUUAUUGCAGAAAGUAUGCCCCUUUGUACGCAGCAGAGGCAAAGAGAGUGUUCUCCCUUGAGAAGAA GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUCUACUCCUACAUGGGAGUCCCGGUGCUGGUAAGUCCGU
......................................................................................................................................<....>.......<........>......<<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..<......< ........><<.<...>.>>..>..>...
X92886.1 0.00 .AGAAACAUGAAUUUUUAAAUAGAUUGAAACAACUGCCCCUAUUGGAAAGCCAGAUUGCUACCAUUGAGCAGAGCGCACCCUCACAGAGCGAUCAGGAGCAACUAUUCUCCAACGUACAGUACUUCGCACAUUAUUGUAGGAAGUAUGCGCCCCUGUAUGCUGCUGAAGCAAAGAGAGUGUUCUCACUUGAGAAGAA AAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUACUCCUUCAUG
...............................................................................................................................................................<....>.......<........>.......<<..... .........>>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>.......... ....
Y14459.1 0.00 .UACCACCAAUUUAAAGACUUUACCAUUACUGGAAGCGCAGGUCGCAACUUUGGAACACUCCUGCCCAACCACUGAACAACAGGAGACCAUCUUUGGAAACAUUCAGUACCUAGCUCACCACUGCAGGAGAUAUGCCCCACUUUAUGCAGCUGAAGCCAGAAGGGUCUAUGCCUUAGAAAAGAG AAUUUUAGGAUACAUACAGUUCAAGAGCAAGCAACGGAUUGAGCCUGUAUGUCUCCUGAUUCACGGCACAGCUGGCAC
..................................................................................................................................................<....>.......<........>.......<...... ..........>.<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>.........< ........>...<...>