Seq ID Score (bits) Sequence
AF029859.2 0.00 GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUACUUCUC
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
AF039205.1 0.00 AAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCUUGCUACUA
......<<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>>
AF081485.1 0.00 GAUGAGCAAUUACAUACAAUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGUUCCUA
.......<....<<<<<..<<<<<...<.......>..>>>>>...>>>>>........>.
AF083069.1 0.00 GAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUGCUCCUA
......<<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>>
AF085363.1 0.00 GAUGAGCAAUUACAUACAAUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUCCUA
.......<....<<<<<..<<<<<...<.......>..>>>>>...>>>>>........>.
AF114383.1 0.00 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUGCUCCUA
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
AF119795.2 0.00 AAUGAAUAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGCCUAAUCAUC
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
AF162711.1 0.00 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUACUCCUA
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
AF177911.1 0.00 GAUGAACAACUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCCGUAUGUUUGAUCAUU
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
AF201894.1 0.00 GAUGAAUAACUACAUACAGUUCAAGAGCAAAUCAAGGAUUGAACCCGUAUGUUUAUUAAUC
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
AF231763.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUCCUG
......<<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>>
AF241359.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUCUGCUCUUA
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
AF268065.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUCUCUUGCUC
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
AF302996.1 0.00 AAUGAAUUAUUACAUGCAGUUCAAGAGCAAACACCGAAUUGAACCUGUAUGUCUUAUUAUU
............<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>..........
AF304459.1 0.00 AAUGAAUAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGCCUAAUUAUC
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
AF311938.1 0.00 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUACUGCUA
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
AF311939.1 0.00 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCCUAUUGCUA
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
AF316321.2 0.00 AAUGAACAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGUCUCAUCAUU
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
AF405666.1 0.00 AAUAAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUCUGUUGGUA
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
AF405669.1 0.00 CAUCAAUAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUAGUG
......<<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>>
AF405682.1 0.00 CAUUAAUAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUAGUA
......<<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>>
AF462418.1 0.00 CAUAAAUAAUUACGUACAGUUCAAGAGCAAGCACCGUAUUGAGCCAGUAUGUUUGUUAGUG
......<<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>>
AF462419.1 0.00 CAUAAAUAAUUACGUACAGUUCAAGAGCAAGCACCGUAUUGAGCCAGUAUGUUUGUUAGUA
......<<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>>
AF504533.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUACUCCUG
......<<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>>
AF504534.1 0.00 GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUUUAUUGCUG
......<<....<<.<<.<<<<<<...<.......>..>>>>>>..>>.>>........>>
AF504536.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUUUAUUGCUG
......<<....<<.<<.<<<<<<...<.......>..>>>>>>..>>.>>........>>
AJ132960.1 0.00 CAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGCUAGUG
......<<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>>
AJ132961.1 0.00 UAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGCUUGCUAGUG
......<<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>>
AJ276224.1 0.00 GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUCUUUUGCUC
.......<....<<.<<.<<<<<<...<.......>..>>>>>>..>>.>>........>.
AJ293918.1 0.00 AAUUAACAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGCUUGUUAGUG
......<<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>>
AJ295172.1 0.00 ACUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCCGUAUGUUUGCUCCUA
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
AJ295214.1 0.00 GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUCUCUUGCUU
.......<....<<.<<.<<<<<<...<.......>..>>>>>>..>>.>>........>.
AJ416942.1 0.00 CAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGCUAGUA
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
AY036578.1 0.00 AAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGCAUUGAACCUGUCUGUCUUCUGCUC
.......<....<<.<<.<<<<<<...<.......>..>>>>>>..>>.>>........>.
AY036579.1 0.00 GAUGAGUAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCCGUAUGUCUGCUCUUG
......<<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>>
AY056701.1 0.00 AAUUAAUAAUUACAUACAGUUCAAGAGCAAACACCGGAUUGAACCAGUAUGUCUAUUAGUG
......<<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>>
D00435.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUCUCUUGCUC
.......<....<<.<<.<<<<<<...<.......>..>>>>>>..>>.>>........>.
D00538.1 0.00 AAUAAACAAUUAUAUACAGUUCAAGAGCAAACACCGUAUUGAGCCAGUAUGUAUGCUCGUU
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
D00625.1 0.00 GAUUAACAACUACGUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUGGUG
......<<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>>
D00627.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUGCUCCUA
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
D00820.1 0.00 AAUUAACAACUACAUACAGUUCAAGUCCAAAUCUCGCAUUGAACCAGUAUGUUUGAUAAUA
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
D10582.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUCUACUUCUA
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
D90457.1 0.00 CAUUAACAACUAUAUCCAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUAUGUUGAUA
.......<....<<<.<.<<<<<<...<.......>..>>>>>>..>.>>>........>.
K01392.1 0.00 CAUUAAUAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAGCCAGUAUGUUUGUUAGUG
......<<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>>
M16560.1 0.00 AAUGAGUAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCUUGCUCUUG
......<<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>>
U05876.1 0.00 GAUGAAUAACUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGUCUCAUCAUC
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
U22521.1 0.00 GAUGAAUAACUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGCUUGAUCAUC
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
U22522.1 0.00 AAUGAAUAAUUACAUGCAGUUCAAGAGCACACACCGUAUUGAACCUGUAUGUCUCAUCAUC
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
U57056.1 0.00 GAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUCUGCUCCUG
......<<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>>
V01148.1 0.00 UAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGCUAGUA
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
X04468.1 0.00 GAUUAACAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUAGUA
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
X05690.1 0.00 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCUUGCUUUUG
......<<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>>
X67706.1 0.00 AAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUUCUG
......<<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>>
X84981.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUCUACUCCUA
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
X92886.1 0.00 AAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUACUCCUU
.......<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>.
Y14459.1 0.00 AAUUUUAGGAUACAUACAGUUCAAGAGCAAGCAACGGAUUGAGCCUGUAUGUCUCCUGAUU
......<<....<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>........>>