Seq ID Score (bits) Sequence
AF029859.2 94.90 GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUACUUCUC
<<.<<<.<<..<<<<<<<<<<<<<...<.......>..>>>>>>.>>>>>>>>>.>>>.>>
AF039205.1 93.21 AAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCUUGCUACUA
.<..<<<<<...<<<<<<<<<<<<...<.......>..>>>>>>.>>>>>>.>>>>>..>.
AF081485.1 93.69 GAUGAGCAAUUACAUACAAUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGUUCCUA
.<.<<<<<<..<<<<<<<.<<<<<...<.......>..>>>>>..>>>>>>>>>>>>>.>.
AF083069.1 97.61 GAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUGCUCCUA
.<.<<<<<<..<<<<<<<<<<<<<...<.......>..>>>>>>.>>>>>>>>>>>>>.>.
AF085363.1 94.98 GAUGAGCAAUUACAUACAAUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUCCUA
.<.<<<<<<..<<<<<<<.<<<<<...<.......>..>>>>>..>>>>>>>>>>>>>.>.
AF114383.1 98.30 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUGCUCCUA
.<.<<<<<<..<<<<<<<<<<<<<...<.......>..>>>>>>.>>>>>>>>>>>>>.>.
AF119795.2 87.73 AAUGAAUAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGCCUAAUCAUC
.<<<<.<<....<<<<<<<<<<<<..<<.......>>.>>>>>>.>>>>>>..>>.>>>>.
AF162711.1 97.24 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUACUCCUA
.<.<<<.<<..<<<<<<<<<<<<<...<.......>..>>>>>>.>>>>>>>>>.>>>.>.
AF177911.1 88.82 GAUGAACAACUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCCGUAUGUUUGAUCAUU
<<<<<.<<<..<<<<<<.<<<<<<..<<.......>>.>>>>>>..>>>>>>>>>.>>>>>
AF201894.1 73.03 GAUGAAUAACUACAUACAGUUCAAGAGCAAAUCAAGGAUUGAACCCGUAUGUUUAUUAAUC
<<<.<<<<<..<<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>>>>>>>.>>>
AF231763.1 99.50 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUCCUG
.<.<<<<<<..<<<<<<<<<<<<<...<.......>..>>>>>>.>>>>>>>>>>>>>.>.
AF241359.1 94.81 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUCUGCUCUUA
.<.<<<<<...<<<<<<<<<<<<<...<.......>..>>>>>>.>>>>>>>.>>>>>.>.
AF268065.1 93.88 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUCUCUUGCUC
<<..<<.<...<<<<<<<<<<<<<...<.......>..>>>>>>.>>>>>>>.>.>>..>>
AF302996.1 76.81 AAUGAAUUAUUACAUGCAGUUCAAGAGCAAACACCGAAUUGAACCUGUAUGUCUUAUUAUU
<<<<<......<<<<<<<<<<<<<...<.......>..>>>>>>.>>>>>>>....>>>>>
AF304459.1 86.08 AAUGAAUAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGCCUAAUUAUC
.<<<<.<<....<<<<<<<<<<<<..<<.......>>.>>>>>>.>>>>>>..>>.>>>>.
AF311938.1 95.97 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUACUGCUA
.<..<<.<<..<<<<<<<<<<<<<...<.......>..>>>>>>.>>>>>>>>>.>>..>.
AF311939.1 92.80 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCCUAUUGCUA
.<..<<.<....<<<<<<<<<<<<...<.......>..>>>>>>.>>>>>>..>.>>..>.
AF316321.2 90.39 AAUGAACAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGUCUCAUCAUU
<<<<<..<...<<<<<<<<<<<<<..<<.......>>.>>>>>>.>>>>>>>.>..>>>>>
AF405666.1 90.35 AAUAAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUCUGUUGGUA
.<<.<<<<...<<<<<<.<<<<<<..<<.......>>.>>>>>>..>>>>>>.>>>>.>>.
AF405669.1 89.83 CAUCAAUAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUAGUG
<<<.<<<<<..<<<<<<.<<<<<<..<<.......>>.>>>>>>..>>>>>>>>>>>.>>>
AF405682.1 93.54 CAUUAAUAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUAGUA
.<<<<<<<<..<<<<<<.<<<<<<..<<.......>>.>>>>>>..>>>>>>>>>>>>>>.
AF462418.1 82.53 CAUAAAUAAUUACGUACAGUUCAAGAGCAAGCACCGUAUUGAGCCAGUAUGUUUGUUAGUG
<<<.<<<<<..<<<<<<.<<<<<<..<<.......>>.>>>>>>..>>>>>>>>>>>.>>>
AF462419.1 82.25 CAUAAAUAAUUACGUACAGUUCAAGAGCAAGCACCGUAUUGAGCCAGUAUGUUUGUUAGUA
.<<.<<<<<..<<<<<<.<<<<<<..<<.......>>.>>>>>>..>>>>>>>>>>>.>>.
AF504533.1 98.44 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUACUCCUG
.<.<<<.<<..<<<<<<<<<<<<<...<.......>..>>>>>>.>>>>>>>>>.>>>.>.
AF504534.1 92.15 GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUUUAUUGCUG
.<..<<.<<..<<<.<<<<<<<<<...<.......>..>>>>>>.>>>.>>>>>.>>..>.
AF504536.1 92.82 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUUUAUUGCUG
.<..<<.<<..<<<.<<<<<<<<<...<.......>..>>>>>>.>>>.>>>>>.>>..>.
AJ132960.1 92.50 CAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGCUAGUG
<<<<<.<<<..<<<<<<.<<<<<<..<<.......>>.>>>>>>..>>>>>>>>>.>>>>>
AJ132961.1 88.78 UAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGCUUGCUAGUG
<<<<<.<<<...<<<<<.<<<<<<..<<.......>>.>>>>>>..>>>>>.>>>.>>>>>
AJ276224.1 89.18 GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUCUUUUGCUC
<<..<<.<...<<<.<<<<<<<<<...<.......>..>>>>>>.>>>.>>>.>.>>..>>
AJ293918.1 92.14 AAUUAACAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGCUUGUUAGUG
.<<<<<<<<...<<<<<.<<<<<<..<<.......>>.>>>>>>..>>>>>.>>>>>>>>.
AJ295172.1 89.49 ACUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCCGUAUGUUUGCUCCUA
...<<<<<<..<<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>>>>>>>>...
AJ295214.1 88.73 GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUCUCUUGCUU
<<..<<.<...<<<.<<<<<<<<<...<.......>..>>>>>>.>>>.>>>.>.>>..>>
AJ416942.1 92.21 CAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGCUAGUA
.<<<<.<<<..<<<<<<.<<<<<<..<<.......>>.>>>>>>..>>>>>>>>>.>>>>.
AY036578.1 85.76 AAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGCAUUGAACCUGUCUGUCUUCUGCUC
.<..<<.<...<<<.<<<<<<<<<...<.......>..>>>>>>.>>>.>>>.>.>>..>.
AY036579.1 91.52 GAUGAGUAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCCGUAUGUCUGCUCUUG
.<.<<<<<...<<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>>.>>>>>.>.
AY056701.1 88.71 AAUUAAUAAUUACAUACAGUUCAAGAGCAAACACCGGAUUGAACCAGUAUGUCUAUUAGUG
.<<<<<<<...<<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>>.>>>>>>>.
D00435.1 90.81 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUCUCUUGCUC
<<..<<.<...<<<.<<<<<<<<<...<.......>..>>>>>>.>>>.>>>.>.>>..>>
D00538.1 80.46 AAUAAACAAUUAUAUACAGUUCAAGAGCAAACACCGUAUUGAGCCAGUAUGUAUGCUCGUU
<<<.<.<<...<<<<<<.<<<<<<..<<.......>>.>>>>>>..>>>>>>.>>.>.>>>
D00625.1 89.14 GAUUAACAACUACGUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUGGUG
.<<<<<<<<..<<<<<<.<<<<<<..<<.......>>.>>>>>>..>>>>>>>>>>>>>>.
D00627.1 98.30 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUGCUCCUA
.<.<<<<<<..<<<<<<<<<<<<<...<.......>..>>>>>>.>>>>>>>>>>>>>.>.
D00820.1 82.91 AAUUAACAACUACAUACAGUUCAAGUCCAAAUCUCGCAUUGAACCAGUAUGUUUGAUAAUA
.<<<<.<<<..<<<<<<.<<<<<<...<.......>..>>>>>>..>>>>>>>>>.>>>>.
D10582.1 96.11 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUCUACUUCUA
.<.<<<.<...<<<<<<<<<<<<<...<.......>..>>>>>>.>>>>>>>.>.>>>.>.
D90457.1 78.10 CAUUAACAACUAUAUCCAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUAUGUUGAUA
.<<<<<<<...<<<<.<.<<<<<<..<<.......>>.>>>>>>..>.>>>>.>>>>>>>.
K01392.1 92.43 CAUUAAUAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAGCCAGUAUGUUUGUUAGUG
<<<<<<<<<..<<<<<<.<<<<<<..<<.......>>.>>>>>>..>>>>>>>>>>>>>>>
M16560.1 92.65 AAUGAGUAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCUUGCUCUUG
.<.<<<<<<...<<<<<<<<<<<<...<.......>..>>>>>>.>>>>>>.>>>>>>.>.
U05876.1 89.17 GAUGAAUAACUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGUCUCAUCAUC
<<<<<..<...<<<<<<<<<<<<<..<<.......>>.>>>>>>.>>>>>>>.>..>>>>>
U22521.1 90.28 GAUGAAUAACUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGCUUGAUCAUC
<<<<<.<<<...<<<<<<<<<<<<..<<.......>>.>>>>>>.>>>>>>.>>>.>>>>>
U22522.1 84.07 AAUGAAUAAUUACAUGCAGUUCAAGAGCACACACCGUAUUGAACCUGUAUGUCUCAUCAUC
.<<<<..<...<<<<<<<<<<<<<..<<.......>>.>>>>>>.>>>>>>>.>..>>>>.
U57056.1 96.54 GAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUCUGCUCCUG
.<.<<<<<...<<<<<<<<<<<<<...<.......>..>>>>>>.>>>>>>>.>>>>>.>.
V01148.1 91.17 UAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGCUAGUA
<<<<<.<<<..<<<<<<.<<<<<<..<<.......>>.>>>>>>..>>>>>>>>>.>>>>>
X04468.1 95.21 GAUUAACAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUAGUA
.<<<<<<<<..<<<<<<.<<<<<<..<<.......>>.>>>>>>..>>>>>>>>>>>>>>.
X05690.1 92.36 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCUUGCUUUUG
.<.<<<<<<...<<<<<<<<<<<<...<.......>..>>>>>>.>>>>>>.>>>>>>.>.
X67706.1 96.68 AAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUUCUG
.<.<<<<<<..<<<<<<<<<<<<<...<.......>..>>>>>>.>>>>>>>>>>>>>.>.
X84981.1 96.37 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUCUACUCCUA
.<.<<<.<...<<<<<<<<<<<<<...<.......>..>>>>>>.>>>>>>>.>.>>>.>.
X92886.1 97.53 AAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUACUCCUU
<<.<<<.<<..<<<<<<<<<<<<<...<.......>..>>>>>>.>>>>>>>>>.>>>.>>
Y14459.1 55.37 AAUUUUAGGAUACAUACAGUUCAAGAGCAAGCAACGGAUUGAGCCUGUAUGUCUCCUGAUU
<<<<...<<..<<<<<<<<<<<<<...<.......>..>>>>>>.>>>>>>>>>...>>>>