Seq ID Score (bits) Sequence
AF029859.2 0.00 GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUACUUCUC
.<>..<...<<....................<>.<>.....>>...<.....<.>.>.>..
AF039205.1 0.00 AAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCUUGCUACUA
.<>..<<>.<<....................<>.<>.....>>..<<.....<.>.>>>..
AF081485.1 0.00 GAUGAGCAAUUACAUACAAUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGUUCCUA
.<>..<...<<....................<>.<>.....>>...<.<...<.>>>.>..
AF083069.1 0.00 GAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUGCUCCUA
.<>..<<>.<<....................<>.<>.....>>...<.....<.>.>.>..
AF085363.1 0.00 GAUGAGCAAUUACAUACAAUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUCCUA
.<>..<...<<....................<>.<>.....>>...<.....<.>.>.>..
AF114383.1 0.00 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUGCUCCUA
.<>..<...<<....................<>.<>.....>>...<.....<.>.>.>..
AF119795.2 0.00 AAUGAAUAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGCCUAAUCAUC
.<>...<>.<<.......................<>.....>>...<.........>....
AF162711.1 0.00 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUACUCCUA
.<>..<...<<....................<>.<>.....>>...<.....<.>.>.>..
AF177911.1 0.00 GAUGAACAACUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCCGUAUGUUUGAUCAUU
.<>.<.....<.......................<>.....>....<.....<.>.>...>
AF201894.1 0.00 GAUGAAUAACUACAUACAGUUCAAGAGCAAAUCAAGGAUUGAACCCGUAUGUUUAUUAAUC
.<>...<>..<..............................>....<.<...<.>>>....
AF231763.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUCCUG
.<>..<...<<....................<>.<>.....>>...<.....<.>.>.>..
AF241359.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUCUGCUCUUA
.<>..<...<<....................<>.<>.....>>...<.....<.>.>.>..
AF268065.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUCUCUUGCUC
.<>..<...<<....................<>.<>.....>>..<<.<......>>>>..
AF302996.1 0.00 AAUGAAUUAUUACAUGCAGUUCAAGAGCAAACACCGAAUUGAACCUGUAUGUCUUAUUAUU
.<>.<....<<.......................<>.....>>...<.........>...>
AF304459.1 0.00 AAUGAAUAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGCCUAAUUAUC
.<>...<>.<<.......................<>.....>>...<.........>....
AF311938.1 0.00 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUACUGCUA
.<>..<...<<....................<>.<>.....>>..<<.....<.>.>>>..
AF311939.1 0.00 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCCUAUUGCUA
.<>..<...<<....................<>.<>.....>>..<<.<......>>>>..
AF316321.2 0.00 AAUGAACAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGUCUCAUCAUU
.<>.<....<<.......................<>.....>>...<.........>...>
AF405666.1 0.00 AAUAAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUCUGUUGGUA
.<>.......<.......................<>.....>....<.<...<.>>>....
AF405669.1 0.00 CAUCAAUAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUAGUG
.<>...<>..<.......................<>.....>....<.<...<.>>>....
AF405682.1 0.00 CAUUAAUAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUAGUA
.<>...<>.<<.......................<>.....>>...<.<...<.>>>....
AF462418.1 0.00 CAUAAAUAAUUACGUACAGUUCAAGAGCAAGCACCGUAUUGAGCCAGUAUGUUUGUUAGUG
.<>...<>.<<.......................<>.....>>...<.<...<.>>>....
AF462419.1 0.00 CAUAAAUAAUUACGUACAGUUCAAGAGCAAGCACCGUAUUGAGCCAGUAUGUUUGUUAGUA
.<>...<>.<<.......................<>.....>>...<.<...<.>>>....
AF504533.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUACUCCUG
.<>..<...<<....................<>.<>.....>>...<.....<.>.>.>..
AF504534.1 0.00 GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUUUAUUGCUG
.<>..<....<....................<>.<>.....>...<<.....<.>.>>>..
AF504536.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUUUAUUGCUG
.<>..<...<<....................<>.<>.....>>..<<.....<.>.>>>..
AJ132960.1 0.00 CAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGCUAGUG
.<>.......<.......................<>.....>....<.....<.>.>....
AJ132961.1 0.00 UAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGCUUGCUAGUG
.<>.......<.......................<>.....>....<.....<.>.>....
AJ276224.1 0.00 GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUCUUUUGCUC
.<>..<....<....................<>.<>.....>...<<.........>>>..
AJ293918.1 0.00 AAUUAACAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGCUUGUUAGUG
<<>>.....<<.......................<>.....>>...<.<...<.>>>....
AJ295172.1 0.00 ACUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCCGUAUGUUUGCUCCUA
.....<...<<....................<>.<>.....>>...<.....<.>.>.>..
AJ295214.1 0.00 GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUCUCUUGCUU
.<>.<<....<....................<>.<>.....>...<<.........>>>.>
AJ416942.1 0.00 CAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGCUAGUA
.<>.......<.......................<>.....>....<.....<.>.>....
AY036578.1 0.00 AAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGCAUUGAACCUGUCUGUCUUCUGCUC
.<>..<....<....................<>.<>.....>...<<.........>>>..
AY036579.1 0.00 GAUGAGUAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCCGUAUGUCUGCUCUUG
.<>..<<>..<....................<>.<>.....>....<.....<.>.>.>..
AY056701.1 0.00 AAUUAAUAAUUACAUACAGUUCAAGAGCAAACACCGGAUUGAACCAGUAUGUCUAUUAGUG
<<>>..<>.<<......................<<>>....>>...<.<......>>....
D00435.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUCUCUUGCUC
.<>..<...<<....................<>.<>.....>>..<<.........>>>..
D00538.1 0.00 AAUAAACAAUUAUAUACAGUUCAAGAGCAAACACCGUAUUGAGCCAGUAUGUAUGCUCGUU
.<>.<....<<.......................<>.....>>...<.........>...>
D00625.1 0.00 GAUUAACAACUACGUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUGGUG
<<>>......<.......................<>.....>....<.<...<.>>>....
D00627.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUGCUCCUA
.<>..<...<<....................<>.<>.....>>...<.....<.>.>.>..
D00820.1 0.00 AAUUAACAACUACAUACAGUUCAAGUCCAAAUCUCGCAUUGAACCAGUAUGUUUGAUAAUA
<<>>......<.......................<>.....>....<.....<.>.>....
D10582.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUCUACUUCUA
.<>..<...<<....................<>.<>.....>>...<.........>.>..
D90457.1 0.00 CAUUAACAACUAUAUCCAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUAUGUUGAUA
.<>.......<.......................<>.....>....<.<......>>....
K01392.1 0.00 CAUUAAUAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAGCCAGUAUGUUUGUUAGUG
.<>...<>.<<.......................<>.....>>...<.<...<.>>>....
M16560.1 0.00 AAUGAGUAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCUUGCUCUUG
.<>..<<>..<....................<>.<>.....>....<.....<.>.>.>..
U05876.1 0.00 GAUGAAUAACUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGUCUCAUCAUC
.<>...<>..<.......................<>.....>....<.........>....
U22521.1 0.00 GAUGAAUAACUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGCUUGAUCAUC
.<>...<>..<.......................<>.....>....<.....<.>.>....
U22522.1 0.00 AAUGAAUAAUUACAUGCAGUUCAAGAGCACACACCGUAUUGAACCUGUAUGUCUCAUCAUC
.<>...<>.<<....<.............>....<>.....>>...<.........>....
U57056.1 0.00 GAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUCUGCUCCUG
.<>..<<>.<<....................<>.<>.....>>...<.....<.>.>.>..
V01148.1 0.00 UAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGCUAGUA
.<>.......<.......................<>.....>....<.....<.>.>....
X04468.1 0.00 GAUUAACAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUAGUA
<<>>.....<<.......................<>.....>>...<.<...<.>>>....
X05690.1 0.00 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCUUGCUUUUG
.<>..<...<<....................<>.<>.....>>...<.....<.>.>.>..
X67706.1 0.00 AAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUUCUG
.<>..<<>.<<....................<>.<>.....>>...<.....<.>.>.>..
X84981.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUCUACUCCUA
.<>..<...<<....................<>.<>.....>>...<.........>.>..
X92886.1 0.00 AAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUACUCCUU
.<>.<<....<....................<>.<>.....>....<.....<.>.>.>.>
Y14459.1 0.00 AAUUUUAGGAUACAUACAGUUCAAGAGCAAGCAACGGAUUGAGCCUGUAUGUCUCCUGAUU
<<>>.<....<.......................<>.....>...<<.........>>>..