Seq ID Score (bits) Sequence
AF029859.2 0.00 GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUACUUCUC
.....<.........................<>...................<.>...>..
AF039205.1 0.00 AAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCUUGCUACUA
.....<.........................<>............<......<.>..>>..
AF081485.1 0.00 GAUGAGCAAUUACAUACAAUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGUUCCUA
.....<.........................<>...................<.>...>..
AF083069.1 0.00 GAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUGCUCCUA
.....<.........................<>...................<.>...>..
AF085363.1 0.00 GAUGAGCAAUUACAUACAAUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUCCUA
.....<.........................<>...................<.>...>..
AF114383.1 0.00 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUGCUCCUA
.....<.........................<>...................<.>...>..
AF119795.2 0.00 AAUGAAUAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGCCUAAUCAUC
.............................................................
AF162711.1 0.00 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUACUCCUA
.....<.........................<>...................<.>...>..
AF177911.1 0.00 GAUGAACAACUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCCGUAUGUUUGAUCAUU
....................................................<.>......
AF201894.1 0.00 GAUGAAUAACUACAUACAGUUCAAGAGCAAAUCAAGGAUUGAACCCGUAUGUUUAUUAAUC
....................................................<.>......
AF231763.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUCCUG
.....<.........................<>...................<.>...>..
AF241359.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUCUGCUCUUA
.....<.........................<>...................<.>...>..
AF268065.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUCUCUUGCUC
.....<.........................<>............<...........>>..
AF302996.1 0.00 AAUGAAUUAUUACAUGCAGUUCAAGAGCAAACACCGAAUUGAACCUGUAUGUCUUAUUAUU
.............................................................
AF304459.1 0.00 AAUGAAUAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGCCUAAUUAUC
.............................................................
AF311938.1 0.00 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUACUGCUA
.....<.........................<>............<......<.>..>>..
AF311939.1 0.00 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCCUAUUGCUA
.....<.........................<>............<...........>>..
AF316321.2 0.00 AAUGAACAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGUCUCAUCAUU
.............................................................
AF405666.1 0.00 AAUAAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUCUGUUGGUA
....................................................<.>......
AF405669.1 0.00 CAUCAAUAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUAGUG
....................................................<.>......
AF405682.1 0.00 CAUUAAUAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUAGUA
....................................................<.>......
AF462418.1 0.00 CAUAAAUAAUUACGUACAGUUCAAGAGCAAGCACCGUAUUGAGCCAGUAUGUUUGUUAGUG
....................................................<.>......
AF462419.1 0.00 CAUAAAUAAUUACGUACAGUUCAAGAGCAAGCACCGUAUUGAGCCAGUAUGUUUGUUAGUA
....................................................<.>......
AF504533.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUACUCCUG
.....<.........................<>...................<.>...>..
AF504534.1 0.00 GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUUUAUUGCUG
.....<.........................<>............<......<.>..>>..
AF504536.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUUUAUUGCUG
.....<.........................<>............<......<.>..>>..
AJ132960.1 0.00 CAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGCUAGUG
....................................................<.>......
AJ132961.1 0.00 UAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGCUUGCUAGUG
....................................................<.>......
AJ276224.1 0.00 GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUCUUUUGCUC
.....<.........................<>............<...........>>..
AJ293918.1 0.00 AAUUAACAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGCUUGUUAGUG
<..>................................................<.>......
AJ295172.1 0.00 ACUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCCGUAUGUUUGCUCCUA
.....<.........................<>...................<.>...>..
AJ295214.1 0.00 GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUCUCUUGCUU
.....<.........................<>............<...........>>..
AJ416942.1 0.00 CAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGCUAGUA
....................................................<.>......
AY036578.1 0.00 AAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGCAUUGAACCUGUCUGUCUUCUGCUC
.....<.........................<>............<...........>>..
AY036579.1 0.00 GAUGAGUAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCCGUAUGUCUGCUCUUG
.....<.........................<>...................<.>...>..
AY056701.1 0.00 AAUUAAUAAUUACAUACAGUUCAAGAGCAAACACCGGAUUGAACCAGUAUGUCUAUUAGUG
<..>.............................<..>........................
D00435.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUCUCUUGCUC
.....<.........................<>............<...........>>..
D00538.1 0.00 AAUAAACAAUUAUAUACAGUUCAAGAGCAAACACCGUAUUGAGCCAGUAUGUAUGCUCGUU
.............................................................
D00625.1 0.00 GAUUAACAACUACGUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUGGUG
<..>................................................<.>......
D00627.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUGCUCCUA
.....<.........................<>...................<.>...>..
D00820.1 0.00 AAUUAACAACUACAUACAGUUCAAGUCCAAAUCUCGCAUUGAACCAGUAUGUUUGAUAAUA
<..>................................................<.>......
D10582.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUCUACUUCUA
.....<.........................<>.........................>..
D90457.1 0.00 CAUUAACAACUAUAUCCAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUAUGUUGAUA
.............................................................
K01392.1 0.00 CAUUAAUAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAGCCAGUAUGUUUGUUAGUG
....................................................<.>......
M16560.1 0.00 AAUGAGUAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCUUGCUCUUG
.....<.........................<>...................<.>...>..
U05876.1 0.00 GAUGAAUAACUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGUCUCAUCAUC
.............................................................
U22521.1 0.00 GAUGAAUAACUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGCUUGAUCAUC
....................................................<.>......
U22522.1 0.00 AAUGAAUAAUUACAUGCAGUUCAAGAGCACACACCGUAUUGAACCUGUAUGUCUCAUCAUC
.............................................................
U57056.1 0.00 GAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUCUGCUCCUG
.....<.........................<>...................<.>...>..
V01148.1 0.00 UAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGCUAGUA
....................................................<.>......
X04468.1 0.00 GAUUAACAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUAGUA
<..>................................................<.>......
X05690.1 0.00 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCUUGCUUUUG
.....<.........................<>...................<.>...>..
X67706.1 0.00 AAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUUCUG
.....<.........................<>...................<.>...>..
X84981.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUCUACUCCUA
.....<.........................<>.........................>..
X92886.1 0.00 AAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUACUCCUU
.....<.........................<>...................<.>...>..
Y14459.1 0.00 AAUUUUAGGAUACAUACAGUUCAAGAGCAAGCAACGGAUUGAGCCUGUAUGUCUCCUGAUU
<..>.<.......................................<...........>>..