Seq ID Score (bits) Sequence
AF029859.2 0.00 GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUACUUCUC
..................<<<<<<..............>>>>>>.................
AF039205.1 0.00 AAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCUUGCUACUA
..................<<<<<<..............>>>>>>.................
AF081485.1 0.00 GAUGAGCAAUUACAUACAAUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGUUCCUA
...................<<<<<..............>>>>>..................
AF083069.1 0.00 GAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUGCUCCUA
..................<<<<<<..............>>>>>>.................
AF085363.1 0.00 GAUGAGCAAUUACAUACAAUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUCCUA
...................<<<<<..............>>>>>..................
AF114383.1 0.00 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUGCUCCUA
..................<<<<<<..............>>>>>>.................
AF119795.2 0.00 AAUGAAUAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGCCUAAUCAUC
..................<<<<<<..............>>>>>>.................
AF162711.1 0.00 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUACUCCUA
..................<<<<<<..............>>>>>>.................
AF177911.1 0.00 GAUGAACAACUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCCGUAUGUUUGAUCAUU
..................<<<<<<..............>>>>>>.................
AF201894.1 0.00 GAUGAAUAACUACAUACAGUUCAAGAGCAAAUCAAGGAUUGAACCCGUAUGUUUAUUAAUC
..................<<<<<<..............>>>>>>.................
AF231763.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUCCUG
..................<<<<<<..............>>>>>>.................
AF241359.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUCUGCUCUUA
..................<<<<<<..............>>>>>>.................
AF268065.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUCUCUUGCUC
..................<<<<<<..............>>>>>>.................
AF302996.1 0.00 AAUGAAUUAUUACAUGCAGUUCAAGAGCAAACACCGAAUUGAACCUGUAUGUCUUAUUAUU
..................<<<<<<..............>>>>>>.................
AF304459.1 0.00 AAUGAAUAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGCCUAAUUAUC
..................<<<<<<..............>>>>>>.................
AF311938.1 0.00 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUACUGCUA
..................<<<<<<..............>>>>>>.................
AF311939.1 0.00 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCCUAUUGCUA
..................<<<<<<..............>>>>>>.................
AF316321.2 0.00 AAUGAACAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGUCUCAUCAUU
..................<<<<<<..............>>>>>>.................
AF405666.1 0.00 AAUAAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUCUGUUGGUA
..................<<<<<<..............>>>>>>.................
AF405669.1 0.00 CAUCAAUAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUAGUG
..................<<<<<<..............>>>>>>.................
AF405682.1 0.00 CAUUAAUAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUAGUA
..................<<<<<<..............>>>>>>.................
AF462418.1 0.00 CAUAAAUAAUUACGUACAGUUCAAGAGCAAGCACCGUAUUGAGCCAGUAUGUUUGUUAGUG
..................<<<<<<..............>>>>>>.................
AF462419.1 0.00 CAUAAAUAAUUACGUACAGUUCAAGAGCAAGCACCGUAUUGAGCCAGUAUGUUUGUUAGUA
..................<<<<<<..............>>>>>>.................
AF504533.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUACUCCUG
..................<<<<<<..............>>>>>>.................
AF504534.1 0.00 GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUUUAUUGCUG
..................<<<<<<..............>>>>>>.................
AF504536.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUUUAUUGCUG
..................<<<<<<..............>>>>>>.................
AJ132960.1 0.00 CAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGCUAGUG
..................<<<<<<..............>>>>>>.................
AJ132961.1 0.00 UAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGCUUGCUAGUG
..................<<<<<<..............>>>>>>.................
AJ276224.1 0.00 GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUCUUUUGCUC
..................<<<<<<..............>>>>>>.................
AJ293918.1 0.00 AAUUAACAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGCUUGUUAGUG
..................<<<<<<..............>>>>>>.................
AJ295172.1 0.00 ACUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCCGUAUGUUUGCUCCUA
..................<<<<<<..............>>>>>>.................
AJ295214.1 0.00 GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUCUCUUGCUU
..................<<<<<<..............>>>>>>.................
AJ416942.1 0.00 CAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGCUAGUA
..................<<<<<<..............>>>>>>.................
AY036578.1 0.00 AAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGCAUUGAACCUGUCUGUCUUCUGCUC
..................<<<<<<..............>>>>>>.................
AY036579.1 0.00 GAUGAGUAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCCGUAUGUCUGCUCUUG
..................<<<<<<..............>>>>>>.................
AY056701.1 0.00 AAUUAAUAAUUACAUACAGUUCAAGAGCAAACACCGGAUUGAACCAGUAUGUCUAUUAGUG
..................<<<<<<..............>>>>>>.................
D00435.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUCUCUUGCUC
..................<<<<<<..............>>>>>>.................
D00538.1 0.00 AAUAAACAAUUAUAUACAGUUCAAGAGCAAACACCGUAUUGAGCCAGUAUGUAUGCUCGUU
..................<<<<<<..............>>>>>>.................
D00625.1 0.00 GAUUAACAACUACGUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUGGUG
..................<<<<<<..............>>>>>>.................
D00627.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUGCUCCUA
..................<<<<<<..............>>>>>>.................
D00820.1 0.00 AAUUAACAACUACAUACAGUUCAAGUCCAAAUCUCGCAUUGAACCAGUAUGUUUGAUAAUA
..................<<<<<<..............>>>>>>.................
D10582.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUCUACUUCUA
..................<<<<<<..............>>>>>>.................
D90457.1 0.00 CAUUAACAACUAUAUCCAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUAUGUUGAUA
..................<<<<<<..............>>>>>>.................
K01392.1 0.00 CAUUAAUAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAGCCAGUAUGUUUGUUAGUG
..................<<<<<<..............>>>>>>.................
M16560.1 0.00 AAUGAGUAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCUUGCUCUUG
..................<<<<<<..............>>>>>>.................
U05876.1 0.00 GAUGAAUAACUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGUCUCAUCAUC
..................<<<<<<..............>>>>>>.................
U22521.1 0.00 GAUGAAUAACUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGCUUGAUCAUC
..................<<<<<<..............>>>>>>.................
U22522.1 0.00 AAUGAAUAAUUACAUGCAGUUCAAGAGCACACACCGUAUUGAACCUGUAUGUCUCAUCAUC
..................<<<<<<..............>>>>>>.................
U57056.1 0.00 GAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUCUGCUCCUG
..................<<<<<<..............>>>>>>.................
V01148.1 0.00 UAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGCUAGUA
..................<<<<<<..............>>>>>>.................
X04468.1 0.00 GAUUAACAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUAGUA
..................<<<<<<..............>>>>>>.................
X05690.1 0.00 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCUUGCUUUUG
..................<<<<<<..............>>>>>>.................
X67706.1 0.00 AAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUUCUG
..................<<<<<<..............>>>>>>.................
X84981.1 0.00 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUCUACUCCUA
..................<<<<<<..............>>>>>>.................
X92886.1 0.00 AAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUACUCCUU
..................<<<<<<..............>>>>>>.................
Y14459.1 0.00 AAUUUUAGGAUACAUACAGUUCAAGAGCAAGCAACGGAUUGAGCCUGUAUGUCUCCUGAUU
..................<<<<<<..............>>>>>>.................