Seq ID Score (bits) Sequence
AF029859.2 67.94 GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUACUUCUC
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
AF039205.1 67.01 AAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCUUGCUACUA
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
AF081485.1 65.77 GAUGAGCAAUUACAUACAAUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGUUCCUA
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
AF083069.1 67.94 GAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUGCUCCUA
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
AF085363.1 65.77 GAUGAGCAAUUACAUACAAUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUCCUA
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
AF114383.1 67.94 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUGCUCCUA
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
AF119795.2 63.81 AAUGAAUAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGCCUAAUCAUC
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
AF162711.1 67.94 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUACUCCUA
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
AF177911.1 57.91 GAUGAACAACUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCCGUAUGUUUGAUCAUU
___________.<<<<<..<<<<<..............>>>>>...>>>>>._________
AF201894.1 44.74 GAUGAAUAACUACAUACAGUUCAAGAGCAAAUCAAGGAUUGAACCCGUAUGUUUAUUAAUC
___________.<<<<<..<<<<<..............>>>>>...>>>>>._________
AF231763.1 69.28 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUCCUG
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
AF241359.1 67.94 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUCUGCUCUUA
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
AF268065.1 69.28 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUCUCUUGCUC
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
AF302996.1 61.41 AAUGAAUUAUUACAUGCAGUUCAAGAGCAAACACCGAAUUGAACCUGUAUGUCUUAUUAUU
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
AF304459.1 63.81 AAUGAAUAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGCCUAAUUAUC
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
AF311938.1 67.94 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUACUGCUA
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
AF311939.1 67.01 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCCUAUUGCUA
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
AF316321.2 66.08 AAUGAACAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGUCUCAUCAUU
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
AF405666.1 62.05 AAUAAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUCUGUUGGUA
___________.<<<<<..<<<<<..............>>>>>...>>>>>._________
AF405669.1 62.05 CAUCAAUAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUAGUG
___________.<<<<<..<<<<<..............>>>>>...>>>>>._________
AF405682.1 62.05 CAUUAAUAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUAGUA
___________.<<<<<..<<<<<..............>>>>>...>>>>>._________
AF462418.1 53.50 CAUAAAUAAUUACGUACAGUUCAAGAGCAAGCACCGUAUUGAGCCAGUAUGUUUGUUAGUG
___________.<<<<<..<<<<<..............>>>>>...>>>>>._________
AF462419.1 53.50 CAUAAAUAAUUACGUACAGUUCAAGAGCAAGCACCGUAUUGAGCCAGUAUGUUUGUUAGUA
___________.<<<<<..<<<<<..............>>>>>...>>>>>._________
AF504533.1 69.28 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUACUCCUG
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
AF504534.1 66.38 GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUUUAUUGCUG
___________.<<.<<<.<<<<<..............>>>>>..>>>.>>._________
AF504536.1 66.38 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUUUAUUGCUG
___________.<<.<<<.<<<<<..............>>>>>..>>>.>>._________
AJ132960.1 62.05 CAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGCUAGUG
___________.<<<<<..<<<<<..............>>>>>...>>>>>._________
AJ132961.1 59.79 UAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGCUUGCUAGUG
___________.<<<<<..<<<<<..............>>>>>...>>>>>._________
AJ276224.1 66.38 GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUCUUUUGCUC
___________.<<.<<<.<<<<<..............>>>>>..>>>.>>._________
AJ293918.1 59.79 AAUUAACAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGCUUGUUAGUG
___________.<<<<<..<<<<<..............>>>>>...>>>>>._________
AJ295172.1 59.77 ACUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCCGUAUGUUUGCUCCUA
___________.<<<<<..<<<<<..............>>>>>...>>>>>._________
AJ295214.1 66.38 GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUCUCUUGCUU
___________.<<.<<<.<<<<<..............>>>>>..>>>.>>._________
AJ416942.1 62.05 CAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGCUAGUA
___________.<<<<<..<<<<<..............>>>>>...>>>>>._________
AY036578.1 62.30 AAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGCAUUGAACCUGUCUGUCUUCUGCUC
___________.<<.<<<.<<<<<..............>>>>>..>>>.>>._________
AY036579.1 61.11 GAUGAGUAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCCGUAUGUCUGCUCUUG
___________.<<<<<..<<<<<..............>>>>>...>>>>>._________
AY056701.1 58.38 AAUUAAUAAUUACAUACAGUUCAAGAGCAAACACCGGAUUGAACCAGUAUGUCUAUUAGUG
___________.<<<<<..<<<<<..............>>>>>...>>>>>._________
D00435.1 66.38 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUCUCUUGCUC
___________.<<.<<<.<<<<<..............>>>>>..>>>.>>._________
D00538.1 56.90 AAUAAACAAUUAUAUACAGUUCAAGAGCAAACACCGUAUUGAGCCAGUAUGUAUGCUCGUU
___________.<<<<<..<<<<<..............>>>>>...>>>>>._________
D00625.1 58.59 GAUUAACAACUACGUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUGGUG
___________.<<<<<..<<<<<..............>>>>>...>>>>>._________
D00627.1 67.94 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUGCUCCUA
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
D00820.1 50.80 AAUUAACAACUACAUACAGUUCAAGUCCAAAUCUCGCAUUGAACCAGUAUGUUUGAUAAUA
___________.<<<<<..<<<<<..............>>>>>...>>>>>._________
D10582.1 69.28 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUCUACUUCUA
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
D90457.1 52.77 CAUUAACAACUAUAUCCAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUAUGUUGAUA
___________.<<<.<..<<<<<..............>>>>>...>.>>>._________
K01392.1 60.71 CAUUAAUAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAGCCAGUAUGUUUGUUAGUG
___________.<<<<<..<<<<<..............>>>>>...>>>>>._________
M16560.1 67.01 AAUGAGUAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCUUGCUCUUG
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
U05876.1 66.08 GAUGAAUAACUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGUCUCAUCAUC
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
U22521.1 63.81 GAUGAAUAACUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGCUUGAUCAUC
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
U22522.1 61.27 AAUGAAUAAUUACAUGCAGUUCAAGAGCACACACCGUAUUGAACCUGUAUGUCUCAUCAUC
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
U57056.1 67.94 GAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUCUGCUCCUG
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
V01148.1 62.05 UAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGCUAGUA
___________.<<<<<..<<<<<..............>>>>>...>>>>>._________
X04468.1 62.05 GAUUAACAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUAGUA
___________.<<<<<..<<<<<..............>>>>>...>>>>>._________
X05690.1 67.01 AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCUUGCUUUUG
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
X67706.1 69.28 AAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUUCUG
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
X84981.1 67.94 GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUCUACUCCUA
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
X92886.1 69.28 AAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUACUCCUU
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________
Y14459.1 55.44 AAUUUUAGGAUACAUACAGUUCAAGAGCAAGCAACGGAUUGAGCCUGUAUGUCUCCUGAUU
___________.<<<<<<.<<<<<..............>>>>>..>>>>>>._________