Seq ID Score (bits) Sequence
AF029859.2 0.00 .AGCAAAAAGAGUGUUCUCGUUGGAGAAAAA GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUACUUCUCCAUGGCAGCCCAGGAGCGGGGAAAUCCGUGGCUACAAACCUAAUUGGUAGAUCCCUCGCGGAGAAACUUAACAGCUCUGUGUACUCGUUACCACCAGACCCAGAUCAUUUUGAUGGAU
.............................. ..................<<<<<<..............>>>>>>................. ...<<....>>...........................................................................................................
AF039205.1 0.00 .GCAGGAAGUACGCGCCCUUGUACGCAGCUGAAGCCAAAAGGGUGUUCUCUCUUGAAAAGAAAAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCC AAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCUUGCUACUACAGCCUCAUUGGGCGAUCACUAGCUGAAAAAUUGAAUAGCUCAGUGUACUCAUUACCACCAGACCCAGA
...............................................................................<<<<<<........... ...>>>>>>....................<<....>>........................ .....................................................................
AF081485.1 0.00 .GCAGAAAGUACGCUCCCCUCUAUGCAGCUGAGGCAAAGAGGGUGUUCUCCCUUGAAAAGAAGAUGAGCAAUUACAUACAAUUCAAGUCCAAAUGCCG GAUGAGCAAUUACAUACAAUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGUUCCUAAACCUAAUUGGAAGGUCACUUGCCGAGAAACUCAAUAGCUCAGUGUAUUCAUUACCACCAGACCCAG
................................................................................<<<<<............ ..>>>>>.....................<<....>>......................... ...................................................................
AF083069.1 0.00 .GCAGAAAGUAUGCACCCCUGUAUGCUGCUGAGGCGAAGAGGGUGUUCUCCCUGGAGAAGAAGAUGAGUAAUUACAUACAGU GAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUGCUCCUACAAAUCGGUAGCAACAAAUCUAAUUGGAAGAUCACUAGCUGAAAAGCUUAACAGCUCAGUGUACUCACUACCACCAGACCCAGAUCACUUCGAUGGCU
...............................................................................<< <<<<..............>>>>>>....................<<....>>......... ..................................................................................................
AF085363.1 0.00 .GCAGAAAGUACGCUCCCCUCUAUGCAGCUGAGGCAAAGAGGGUGUUCUCCCUUGAAAAGAAGAUGAGCAAUUACAUACAAUUCAAGUCCAAAUGCCGUAUUG GAUGAGCAAUUACAUACAAUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUCCUAAAUUGGAAGGUCACUUGCCGAGAAACUCAAUAGCUCAGUGUAUUCACUACCACCAGA
................................................................................<<<<<..............>>> >>.....................<<....>>.............................. .........................................................
AF114383.1 0.00 .UAUGCACCACUUUAUGCAGCUGAGGCAAAAAGGGUCUUCUCCCUUGAAAAGAA AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUGCUCCUACACGGGAGUCCUGGUGCUGGCAAGUCAGUAGCAACAAAUCUAAUUGGAAGGUCACUUGCUGAGAAACUCAACAGUUCAGUGUACUCACUACCACCGGACCCAGAUCACUUCGAUGGCU
..................................................... ..................<<<<<<..............>>>>>>................. ...<<....>>...........................................................................................................
AF119795.2 0.00 .GCCGCAAAUUCCAACCCCUCUAUGCCACGGAAGCAAAGAGGGUGUACGCCCUAGAAAAGAGAAUGAAUAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGCCUAAUCAUCAGAGGCUCGCCUGGUACUGGGAAGUCCUUGGCAACAGG AAUGAAUAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGCCUAAUCAUC
...............................................................................<<<<<<..............>>>>>>....................<<....>>........................... ..___________________________________________________________
AF162711.1 0.00 .AGAA AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUACUCCUACAUGGGAGCCCUGGUGCCGGAAAGUCCGUGGCAACUAACUUGAUUGGGCGGUCACUUGCAGAAAAACUCAACAGCUCAGUGUACUCGUUGCCACCAGACCCUGAUCACUUUGAUGGCU
.... ..................<<<<<<..............>>>>>>................. ...<<....>>...........................................................................................................
AF177911.1 0.00 .CUACGCGACUGAAGCCAAAAGAGUCUAUGCCCUAGAGAAAAG GAUGAACAACUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCCGUAUGUUUGAUCAUUAGAGGCUCUCCAGGAACAGGCAAGUCACUUGCUACGGGCAUCAUAGCUAGAGCUAUUGCUGACAAAUACCAUUCUAGCGUUUACUCACUCCCUCCAGACCCAGACCAUUUUGAUGGAU
.......................................... ..................<<<<<<..............>>>>>>................. ...<<....>>...........................................................................................................
AF201894.1 0.00 .GAA GAUGAAUAACUACAUACAGUUCAAGAGCAAAUCAAGGAUUGAACCCGUAUGUUUAUUAAUCCAUGGGAGUCCUGGUGCUGGAAAGUCUGUGGCAACUUCAAUAAUUGGCCGUGCAAUAGCCGAGAGUAUUUCAGGGUCAGUAUAUUCAUUACCACCGGACCCGACUUUCUUUGAUGGGU
... ..................<<<<<<..............>>>>>>................. ...<<....>>...........................................................................................................
AF231763.1 0.00 .GCAGAAAGUACGCUCCCCUCUACGCAGCUGAAGCAAAGAGGGUGUUCUCCCUUGAGAAGAAGAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUCCUGCACGGGAGCCCUG GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUCCUG
...............................................................................<<<<<<..............>>>>>>....................<<....>>.. ...................................................._________
AF241359.1 0.00 .CACCCCUCUAUGCAUCAGAGGCAAAGAGAGUGUUCUCCCUUGAGAAGAG GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUCUGCUCUUACAUGGGAGUCCCGGUGCAGGCAAGUCAGUGGCAACAAACCUGAUCGGGAGAUCACUCGCUGAAAAGCUUAACAGCUCAGUGUAUUCACUACCCCCAGACCCAGAUCACUUCGAUGGCU
................................................. ..................<<<<<<..............>>>>>>................. ...<<....>>...........................................................................................................
AF268065.1 0.00 .GUCGGAAGUAUGCGCCACUGUAUGCUGCUGAAGCAAAGAGGGUGUUCUCUCUUGAAAAGAAGAUGA GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUCUCUUGCUCUAGCCCAGGUGCUGGGAAGUCAGUGGCAACGAACUUGAUUGGGCGCUCGCUCGCCGAAAAACUCAACAGCUCGGUAUACUCACUACCACCAGAUCCAGACCAUUUUGAUGGUU
.................................................................. .............<<<<<<..............>>>>>>....................<< ....>>...........................................................................................................
AF302996.1 0.00 .CCCUGGAGAAAAG AAUGAAUUAUUACAUGCAGUUCAAGAGCAAACACCGAAUUGAACCUGUAUGUCUUAUUAUUAGGGGCUCACCAGGCACUGGGAAGUCUCUAGCCACUGGCAUCAUUGCUCGAGCAAUCGCUGAUAAGUACCACUCCAGCGUGUACUCACUUCCACCAGACCCAGACCAAUUUGAUGGAU
............. ..................<<<<<<..............>>>>>>................. ...<<....>>...........................................................................................................
AF304459.1 0.00 .AGGGUGUACGCCCUAGAAAAGAG AAUGAAUAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGCCUAAUUAUCAGAGGCUCGCCUGGUACUGGGAAGUCAUUGGCAACAGGGAUUAUUGCUAGAGCCAUAGCAGACAAGUACCACUCCAGUGUGUAUUCCUUACCUCCAGACCCAGACCACUUUGACGGAU
....................... ..................<<<<<<..............>>>>>>................. ...<<....>>...........................................................................................................
AF311938.1 0.00 .GCAGAAAGUAUGCCCCCUUGUAUGCUGCUGAGGCAAAAAGGGUCUUUUCCUUAGAGAAGAAAAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUA AAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUACUGCUACUUGAUUGGGCGGUCACUUGCAGAAAAACUCAACAGCUCAGUGUACUCGUUGCCACCAGACCC
...............................................................................<<<<<<.............. >>>>>>....................<<....>>........................... ...............................................................
AF316321.2 0.00 .GUCGCAAGUUCCAACCAUUAUACGCCACGGAGGCCAAGCGAGUCUAUGUUCUAGAGAAGAGAAUGAACAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGUCUCAUCAUUAGAGGCUCACCAGGC AAUGAACAAUUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGUCUCAUCAUU
...............................................................................<<<<<<..............>>>>>>....................<<....>>.... ................................................_____________
AF405666.1 0.00 .CAAAGAGAUUUGCACCACUUUAUGCACUAGAGGCUAAAAGGAUACAGAAACUAGAACAUACAAUAAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUCUGUUGGUACACGGGAGC AAUAAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUCUGUUGGUA
...............................................................................<<<<<<..............>>>>>>....................<<.... >>.........................................................._
AF405682.1 0.00 .GAGGCAAAGAGAAUACAAAAAUUGGAACACAC CAUUAAUAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUAGUACACGGCAGCCCAGGUACGGGGAAGUCAGUUGCCACCAAUCUGAUUGCCAGGGCCAUUGCUGAGAAAGAGAACACCUCCACUUACUCGCUACCUCCAGACCCCUCACACUUUGAUGGUU
................................ ..................<<<<<<..............>>>>>>................. ...<<....>>...........................................................................................................
AF462418.1 0.00 .CCAAGAGGUUUGCACCACUAUAUGCACAUGAAGCUAAAAGGAUUCAAAAGCUGGAGCAUACCAUAAAUAAUUACGUACAGUUCAAGAGCAAGCACCGUAUUGA CAUAAAUAAUUACGUACAGUUCAAGAGCAAGCACCGUAUUGAGCCAGUAUGUUUGUUAGUGAUUGCUAGAGCGAUAGCCGAGAAAGAGAACACCUCCACAUACUCACUACCACCUG
...............................................................................<<<<<<..............>>>> >>....................<<....>>............................... .......................................................
AF462419.1 0.00 .CCAAGAGGUUUGCACCACUAUAUGCACAUGAAGCUAAAAGGAUUCAAAAGCUGGAGCAUACCAUAAAUAAUUACGUACAGUUCAAGAGCAAGCACCGUAUUGAGCCAGUAUGUUUGUUAG CAUAAAUAAUUACGUACAGUUCAAGAGCAAGCACCGUAUUGAGCCAGUAUGUUUGUUAGUACGAGAAAGAGAACACCUCCAC
...............................................................................<<<<<<..............>>>>>>............... .....<<....>>................................................ .....................
AF504533.1 0.00 .AAA GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUACUCCUGCAUGGAAGCCCUGGUGCAGGGAAGUCGGUCGCCACCAACCUAAUCGGGCGCUCACUGGCCGAGAAGCUAAAUAGUUCAGUCUAUUCCCUGCCACCAGACCCAGACCACUUCGAUGGGU
... ..................<<<<<<..............>>>>>>................. ...<<....>>...........................................................................................................
AF504534.1 0.00 .AGCUAAGAGAGUUUUCUCCCUCGAGAAGAA GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUUUAUUGCUGCAUGGAAGUCCUGGAGCUGGGAAAUCGGUCGCCACCAACCUAAUCGGGCGCUCACUUGCCGAGAAGCUAAACAGUUCGGUGUACUCCCUGCCACCGGACCCCGACCAUUUCGAUGGGU
.............................. ..................<<<<<<..............>>>>>>................. ...<<....>>...........................................................................................................
AJ132960.1 0.00 .AGAGAUUUGCCCCUCUUUACGCAGUGGAAGCCAAAAGAAUACAGAAGCUAGAGCAUAC CAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGCUAGUGCAUGGCAGCCCCGGAACAGGCAAAUCCGUAGCAACCAAUCUGAUCGCUAGAGCCAUAGCUGAAAGAGAAAACACGUCUACGUAUUCGCUACCCCCGGAUCCGUCACACUUUGACGGAU
.......................................................... ..................<<<<<<..............>>>>>>................. ...<<....>>...........................................................................................................
AJ132961.1 0.00 .CCAAGAGAUUUGCCCCUCUCUACGCAAUGGAAGCCAAAAGAAUACAGAAGCUAGAACACACUAU UAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGCUUGCUAGUGGGCAGCCCCGGAACAGGCAAAUCCGUAGCAACCAAUUUGAUCGCUAGAGCCAUAGCUGAAAGGGAAAACACAUCUACGUACUCGCUGCCCCCGGAUCCGUCACACUUCGACGGAU
................................................................ ...............<<<<<<..............>>>>>>.................... <<....>>...........................................................................................................
AJ276224.1 0.00 .GCAGAAAGUAUGCCCCCCUGUAUGCUGCCGAAGCAAAGAGAGUGUUCUCCCUAGAAAAGAAGAUGAGC GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUCUUUUGCUCGCCCCGGUGCUGGUAAGUCAGUGGCAACUAACUUGAUUGGGAGAUCACUUGCUGAGAAACUCAACAGUUCUGUGUACUCACUACCACCAGACCCCGACCAUUUUGACGGAU
.................................................................... ...........<<<<<<..............>>>>>>....................<<.. ..>>...........................................................................................................
AJ293918.1 0.00 .CAAAAAAGUUCGCCCCUCUCUACGCCGUGGAAGCCAAAAGAAUCCAGAAAUUAGAGCACACAAUUAACAAUUACAUAC AAUUAACAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGCUUGUUAGUGGGGCAAAUCGGUUGCCACAAAUUUGAUUGCCAGAGCUAUUGCUGAAAAGGAGAAUACUUCCACGUAUUCAUUGCCCCCGGAUCCUUCCCAUUUUGAUGGGU
.............................................................................. .<<<<<<..............>>>>>>....................<<....>>...... .....................................................................................................
AJ295172.1 0.00 .GCAGGAAAUAUGCUCCCCUAUAUGCAACCGAGGCAAAAAGAGUGUUCUCCCUUGAAAAGAAACUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUA ACUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCCGUAUGUUUGCUCCUACUUAAUUGGCAGAUCCCUUGCAGAAAAACUCAAUAGCUCGGUGUACUCCCUACCACCAGACCC
...............................................................................<<<<<<.............. >>>>>>....................<<....>>........................... ...............................................................
AJ295214.1 0.00 .GCAGGAAGUACGCCCCCCUGUAUGCCGCUGAGGCAAAAAGGGUGUUUUCCUUAGAGAAGAAGAUGAGCAACUACAUACAGU GAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUCUCUUGCUUGAAGUCUGUGGCCACGAAUCUAAUUGGAAGAUCCCUCGCGGAGAAACUCAACAGCUCUGUGUACUCACUACCACCGGACCCAGAUCAUUUUGACGGGU
...............................................................................<< <<<<..............>>>>>>....................<<....>>......... ..................................................................................................
AJ416942.1 0.00 .AGAAUACAGAAACUAGAGCAUAC CAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGCUAGUACAUGGCAGCCCCGGAACAGGUAAAUCUGUAGCAACCAACCUGAUUGCUAGAGCCAUAGCUGAAAGAGAAAACACGUCCACGUACUCGCUACCCCCGGAUCCAUCACACUUCGACGGAU
....................... ..................<<<<<<..............>>>>>>................. ...<<....>>...........................................................................................................
AY036578.1 0.00 .GCAGGAAGUAUGCCCCUUUAUACGCCGCCGAGGCUAAGAGAGUGUUUACCUUGGAGAAGAAAAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGCAUUGAACCUGUCUGUCUUCUGCUCCACGGGAGUCCUGGUGCUGGUAAGUCCGUGG AAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGCAUUGAACCUGUCUGUCUUCUGCUC
...............................................................................<<<<<<..............>>>>>>....................<<....>>.................... ................_____________________________________________
AY036579.1 0.00 .GCAGGAAGUAUGCGCCUUUGUAUGCAGCUGAGGCAAAAAGAGUGUUUUCCCUUGAGAAGAAGAUGAGUAACUACAUACAGUUCAAGUCCAAAUGCC GAUGAGUAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCCGUAUGUCUGCUCUUGAAACUUAAUUGGUAGAUCACUUGCUGAAAAACUCAACAGCUCAGUGUAUUCACUACCCCCGGAUCCGGA
...............................................................................<<<<<<........... ...>>>>>>....................<<....>>........................ .....................................................................
AY056701.1 0.00 .AGGCUAAAAGAAUCCAGAAGUUGGAACACGG AAUUAAUAAUUACAUACAGUUCAAGAGCAAACACCGGAUUGAACCAGUAUGUCUAUUAGUGCAUGGUAGCCCAGGGACAACAAAAUCAGUUGCAACAAACCUGAUUGCCAGAGCAAUAGCAGAAAAGGAAAAUACUUCCAUCUCCCUUCCACCAGACCCUUCUCACUUUGAUGGCU
............................... ..................<<<<<<..............>>>>>>................. ...<<....>>........................................................................................................
D00435.1 0.00 .CGGAAGUAUGCACCAUUGUACGCCGCUGAAGCAAAGAGAGUGUUCUCACUUGAAAAGAA GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUCUGUCUCUUGCUCCAUGGCAGCCCAGGCGCUGGGAAGUCUGUGGCAACGAACUUGAUUGGGCGCUCGCUCGCUGAGAAACUCAACAGCUCGGUGUACUCACUACCACCAGAUCCAGACCAUUUCGAUGGUU
........................................................... ..................<<<<<<..............>>>>>>................. ...<<....>>...........................................................................................................
D00538.1 0.00 .CCCGUCGGUUCGCGCCAUUAUAUGCUGUGGAGGCACGCCGGAUUAGCAAAAUGGAGAGCACAAUAAACAAUUAUAUACAGUUCAAGAGCAAACACCGUAUUGAGCCA AAUAAACAAUUAUAUACAGUUCAAGAGCAAACACCGUAUUGAGCCAGUAUGUAUGCUCGUUGUAGAGCAAUAGCAGAGAGGGAAACCACAUCGGUCUACUCAGUGCCA
...............................................................................<<<<<<..............>>>>>>.. ..................<<....>>................................... ...............................................
D00625.1 0.00 .CAAGGAGAUUUGCCCCGCUCUAUGCGGUCGAGGCUAAGAGAAUACAAAAGUUAGAGCACACGAUUAACAACUACGUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUGGUGCACGGUAGCCCAGGCACGGG GAUUAACAACUACGUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUGGUG
...............................................................................<<<<<<..............>>>>>>....................<<....>>......... ......................................_______________________
D00627.1 0.00 .GGGUGUUCUCCCUUGAGAAAAA GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUUUGCUCCUACAUGGGAGUCCAGGUGCCGGCAAGUCGGUGGCAACAAACCUAAUUGGAAGGUCACUCGCUGAGAAAUUAAACAGUUCAGUGUACUCAUUACCACCAGACCCAGAUCACUUUGAUGGCU
...................... ..................<<<<<<..............>>>>>>................. ...<<....>>...........................................................................................................
D00820.1 0.00 .ACUAGAAGCUAAGAGGGUUUCUGCCUUAGAAAGGAA AAUUAACAACUACAUACAGUUCAAGUCCAAAUCUCGCAUUGAACCAGUAUGUUUGAUAAUACAUGGAUCUCCAGGCACUGGGAAGUCAGUGGCAUCUAACCUCAUUGCCAGAGCUAUUACAGAAAAACUGGGUGGGGAUUCUUACUCACUCCCACCUGAUCCAAAAUAUUUUGAUGGGU
.................................... ..................<<<<<<..............>>>>>>................. ...<<....>>...........................................................................................................
D10582.1 0.00 .AA GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUCUACUUCUACACGGGAGCCCUGGCGCCGGUAAGUCGGUAGCAACAAAUCUAAUCGGAAGAUCACUCGCUGAGAAACUUAACAGCUCAGUGUACACACUACCACCAGACCCAGAUCACUUUGACGGAU
.. ..................<<<<<<..............>>>>>>................. ...<<....>>...........................................................................................................
D90457.1 0.00 .CGCGUAGGUUUGCACCAUUGUACGCAGUUGAGGCUAAAAGAAUUUCUAAAUUGGAAAACACCAUUAACAACUAUAUCCAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUAUGUUGAUACAUGGCUCCCCAGGAACAGGAAAA CAUUAACAACUAUAUCCAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUAUGUUGAUA
...............................................................................<<<<<<..............>>>>>>....................<<....>>............. .............................._______________________________
K01392.1 0.00 .CCAAGAGAUUCGCUCCAUUGUACGCACUUGAGGCCAAGAGAAUACAAAAGUUGGAACACACCAUUAAUAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAGCCAGUAUGUUUGUUAGUGCAUGGG CAUUAAUAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAGCCAGUAUGUUUGUUAGUGAGAAC
...............................................................................<<<<<<..............>>>>>>....................<<. ...>>........................................................ .....
M16560.1 0.00 .GCAGGAAAUACGCACCCCUGUAUGCGGCCGAAGCAAAAAGGGUGUUCUCCCUUGAGAAGAAAAUGAGUAACUACAUACAGU AAUGAGUAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGCUUGCUCUUGGAAGUCAGUUGCCACUAACCUGAUUGGGCGCUCACUCGCGGAGAAGCUUAAUAGCUCUGUGUACUCUCUACCACCAGACCCAGACCAUUUUGACGGUU
...............................................................................<< <<<<..............>>>>>>....................<<....>>......... ..................................................................................................
U05876.1 0.00 .GCCGCAAAUUUCAGCCACUGUACGCUACAGAAGCCAAGAGGGUCUACGCCCUGGAGAAAAGGAUGAAUAACUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGU GAUGAAUAACUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGUCUCAUCAUCCGGGCAAUAGCCGACAAGUACCACUCCAGUGUGUAUUCACUUC
...............................................................................<<<<<<..............>>>>>>.... ................<<....>>..................................... ...........................................
U22521.1 0.00 .GCCGCAAAUUCCAACCACUCUACGCAACUGAGGCCAAGAGAGUCUACGCUUUAGAGAAAAGGAUGAAUAACUACAUGC GAUGAAUAACUACAUGCAGUUCAAGAGCAAACACCGUAUUGAACCUGUAUGCUUGAUCAUCGGGCAAAUCGCUCGCCACAGGCAUUAUAGCUAGAGCCAUUGCUGACAAGUAUCGCUCUAGUGUAUACUCACUCCCCCCAGACCCAGAUCACUUUGAUGGGU
.............................................................................. .<<<<<<..............>>>>>>....................<<....>>...... .....................................................................................................
U22522.1 0.00 .CAAGUUUCAACCAUUGUACGCCACAGAAGCUAAGCGAGUCUAUGUUCUAGAGAAGAG AAUGAAUAAUUACAUGCAGUUCAAGAGCACACACCGUAUUGAACCUGUAUGUCUCAUCAUCAGGGGCUCACCAGGCACUGGAAAAUCCCUUGCGACGGGCAUCAUUGCUCGGGCUAUAGCAGACAAAUAUCACUCCAGUGUGUACUCACUUCCACCAGACCCUGACCAUUUUGACGGAU
......................................................... ..................<<<<<<..............>>>>>>................. ...<<....>>...........................................................................................................
U57056.1 0.00 .GCAGAAAGUAUGCUCCCCUUUAUGCAUCAGAGGCAAAGAGAGUGUUCUCCCUUGAGAAGAAGA GAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUCUGCUCCUGUGGGAGUCCCGGUGCAGGUAAGUCAGUUGCAACAAAUCUGAUCGGAAGAUCACUCGCGGAAAAGUUAAACAGCUCAGUGUAUUCACUACCCCCAGACCCAGAUCACUUCGAUGGCU
............................................................... ................<<<<<<..............>>>>>>................... .<<....>>...........................................................................................................
V01148.1 0.00 .CUAAGAGGUUUGCCCCUCUUUACGCAGUGGAAGCCAAAAGAAUACAGAAACUAGAGCAUACUAUUAACAA UAUUAACAACUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGCUAGUACCCGGAACAGGUAAAUCUGUAGCAACCAACCUGAUUGCUAGAGCCAUAGCUGAAAGAGAAAACACGUCCACGUACUCGCUACCCCCGGAUCCAUCACACUUCGACGGAU
...................................................................... .........<<<<<<..............>>>>>>....................<<.... >>...........................................................................................................
X04468.1 0.00 .AGGCAAAGAGAAUACAGAAGUUGGAACACAC GAUUAACAAUUACAUACAGUUCAAGAGCAAACACCGUAUUGAACCAGUAUGUUUGUUAGUACAUGGUAGCCCCGGAACUGGCAAGUCGGUAGCCACCAACCUAAUAGCUAGGGCUAUAGCGGAGAAGGAAAACACCUCCACAUACUCAUUACCACCAGAUCCAUCUCAUUUCGACGGGU
............................... ..................<<<<<<..............>>>>>>................. ...<<....>>...........................................................................................................
X67706.1 0.00 .GCAGGAAGUAUGCACCACUGUAUGCUGCUGAGGCAAAAAGGGUAUUUUCCCUUGAAAAGAAAAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUUCUGCACGGAAGUCCGGGUGCUGGGAAAUCA AAUGAGUAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUGCUUCUG
...............................................................................<<<<<<..............>>>>>>....................<<....>>................ ........................_____________________________________
X84981.1 0.00 .GCAGAAAGUAUGCCCCUUUGUACGCAGCAGAGGCAAAGAGAGUGUUCUCCCUUGAGAAGAAGAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUCUACUCCUACAUGGGAGUCCCGGUGCUGGUAA GAUGAGCAAUUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAGCCUGUAUGUCUACUCCUA
...............................................................................<<<<<<..............>>>>>>....................<<....>>............ ................................_____________________________
X92886.1 0.00 .GUAGGAAGUAUGCGCCCCUGUAUGCUGCUGAAGCAAAGAGAGUGUUCUCACUUGAGAAGAAAAUGAGCAACUACAUA AAUGAGCAACUACAUACAGUUCAAGUCCAAAUGCCGUAUUGAACCUGUAUGUUUACUCCUUCCGGUAAAUCCGUGGCCACUAACUUGAUUGGCAGAUCCCUCGCAGAAAAACUCAAUAGCUCAGUAUAUUCACUACCACCAGACCCCGACCACUUUGACGGCU
............................................................................. ..<<<<<<..............>>>>>>....................<<....>>..... ......................................................................................................
Y14459.1 0.00 .GCAGGAGAUAUGCCCCACUUUAUGCAGCUGAAGCCAGAAGGGUCUAUGCCUUAGAAAAGAGAAUUUUAGGAUACAUACAGUUCAAGAGCAAGCAACGGAUUGAGCCUGUAUGUCUCCUGAUUCACGGCACAGCUGGCACUGGA AAUUUUAGGAUACAUACAGUUCAAGAGCAAGCAACGGAUUGAGCCUGUAUGUCUCCUGAUU
...............................................................................<<<<<<..............>>>>>>....................<......>.......... ...................................._________________________