Seq ID Score (bits) Sequence
...................................................................................................................................................................... ................<.<.....>>..............................................................................................................<...............................................................................................................>................................................................................................................................................................................................................................... ..................................
................... .................................................................................................................................<.<...>>.....................................................................................................................................................................................................................................................................................................<............................................. >....................................................................................................................................................................................
.................................................. ........................................................................................................................................<...............................................................................................................>................................................................................................................................................................................................................................... ......................................................................................................................................................
.................... .................................................................................................................................<.<...>>...........................................................................................................................................................................................................<...............................................................................................................>....................... ....................................................................................................................................................................................
................................................................... .................................................................................................................................<.<...>>...........................................................................................................................................................................................................<...............................................................................................................>....................... .....................................................................................................................................
.............................................................................. ................................................................................................................................<.<....>>..........................................................................................................................................................................................................................................................................................................<........................................ ....>.....................................................................................................................
.................................................................................................................................. .................................<.....>.................................................................................................................................................................................................................................................................................................................................................................................................................................................... ......................................................................
.............................................................................. ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ..........................................................................................................................
...........................................................................................................................................<.<...>>...................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ...............
...................<.<...>>.... ........................................................................................................................................<...............................................................................................................>................................................................................................................................................................................................................................... .........................................................................................................................................................................
.................................................................................... .................................................................................................................................<.<...>>...........................................................................................................................................................................................................<...............................................................................................................>....................... ....................................................................................................................
.................................................................................................................................................... .................................................................................................................................<.<...>>.......................................................................................................................................................................................................<...................................................................................................................>....................... ....................................................
..................................................................... ................................................................................................................................<...>....................................................................................................................................................................................................................................................................................................................................................... ...................................................................................................................................
...................................................................................................................................................................................................... .................................................................................................................................<.<...>>..........................................................................................................................................................................................................................<................................................................................................>....................... ..
.......................... .................................................................................................................................<.<...>>...........................................................................................................................................................................................................<...............................................................................................................>....................... ..............................................................................................................................................................................
AE009314.1 0.00 .UGACAUUCCGGUGAUAGAUGCCUUGACCAGUUCAACGACAUGCG ACAUUGGUUAGCC.AUCGUGGUu.CUGCGGAc..........GAAGg..........UCCGGAGCU...AAGA.GGGAAU.UCGGUGAgggcuuuaaucacagccu..........GAAU.CCGAAGCUGCCCCCGCAACUGUAA.GCGAc.................................................GAGCGAAAGUCCAUCAU.........................GUCACUGAGG................CCGG...............................................................CCUCGGGAA.GAC..GGA..CCAAAGCUAUGAC...................................................................CCGC..AAGCCAGGAGACCUGCCGCGAUAGAUAACGUCCACGGGCGGGGUGUCCCGGAGUGCCGCUUUCGCGAUAGGUAUUCCCGUGCCUUUG
............................................ .................................................................................................................................<.<...>>...........................................................................................................................................................................................................<...............................................................................................................>....................... ....................................................
........................................................................ ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ................................................................................................................................
..................... ..................................................................................................................................................................................................................................................<.<...>>.................................................................................................................................................................................................................................. ...........<...........................................>...........................................................................................................................
.................................................................................................................................................................................... ....<..........................................................>............................................................................................................................................................................................................................................................................................................................................................................................................................ ....................
........................................................... .............................................................................................................................................<..>.........................................................................................................................................................................................<.........................................................................................................................>....................... .............................................................................................................................................
............................................................................................................................... ...........................<...>.........................................................................................................................<............................................................................................>..................................................................................................................................................................................................................................... .........................................................................
........................................................................................................................................ ..............<.<...>>..........................................................................................................................................<..................................................>........................................................................................................................................................................................................................................................................ ................................................................
AE013011.1 0.00 .AAAGUAAGAGUUAAAAUGAAAUUAAAACU GAAUAUAAAAAGC.CUUAUGGU..CCC----...........GUGAu..........----GGGUU...AAAA.GGGAAGaCGGGUGA............................GAAU.CCCGCGCAGCCCCCGCUACUGUGA.GGGA..................................................GGACGAAGCCCUAGUAA.........................GCCACUGUCCggcac...........UCAA........cugagcgcguuaguaaggagaaaagagggagagaaauugcguucaguugagugccGGAUGGGAA.GGC..AGG..GUGGAGGAUGAG-...................................................................UCCC..GAGCCAGGAGACCUGCCAUAAGGUUUUUAAAAGUUCGCCUUCGGAGGGAAGGUUGAACG
............................. ...............................................................................................................................................................................................................................................................................................................................................<....................................................................................................................>....................... ........................
.............................................................................................................. ............<..<...>>...................................................................................................................<...............................................................................................................>................................................................................................................................................................................................................................... ..........................................................................................
......................................................................................................................................<......>........................................................ ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ..
............................................. .................................................................................................................................<.<...>>...........................................................................................................................................................................................................<...............................................................................................................>....................... ...........................................................................................................................................................
......................................................................................................................................... .................................................................................................................................<.<...>>...........................................................................................................................................................................................................<...............................................................................................................>....................... ...............................................................
........................................................... .................................................................................................................................<.<...>>...........................................................................................................................................................................................................<...............................................................................................................>....................... ...........................................................
................................................................................... .................................................................................................................................<.<...>>.........................................................................................................................................................................................................................................................................<.................................................>....................... .....................................................................................................................
...................................... .........................................................................................................................................................................................................................................................................................................................................................................................................................................................<.................................. ...............>..................................................................................................................................................
......................................... .................................................................................................................................<.<...>>.................................................................................................................................................................................................................<.........................................................................................................>....................... ...............................................................................................................................................................
............................................................................ .................................................................................................................................<.<...>>.................................................................................................................................................................................................................<.........................................................................................................>....................... ............................................................................................................................
......................... .................................................................................................................................<.<...>>................................................................................................................................................................................................................................................................................................................................................... ...............................................................................................................................................................................
............................................................... ................<.<.....>>..............................................................................................................<...............................................................................................................>................................................................................................................................................................................................................................... .........................................................................................................................................
................... ....................................................................................................................................................................................................................................................<...>................................................................................................................................................................................................................................... .....................................................................................................................................................................................
............ ........................................................................................................................................<...............................................................................................................>................................................................................................................................................................................................................................... ............................................................................................................................................................................................
.................................................................................................................... ...............................................................................................................................................<...........................................................................................................................................................................................................>................................................................................................................................ ....................................................................................
............................................................................................................. .................................................................................................................................<.<...>>...........................................................................................................................................................................................................<...............................................................................................................>....................... ...........................................................................................
.......................................................................................................................... ........<...>...........................................................................................................................<.................................................................................................................>................................................................................................................................................................................................................................. ..............................................................................
........................ .................................................................................................................................<.<...>>...........................................................................................................................................................................................................<...............................................................................................................>....................... ................................................................................................................................................................................
............................................................................................................................................<.<...>>.............................. ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ......................
............................................................................................................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ .........................................................
....................................................................................................................... .................................................................................................................................<.<...>>.................................................................................................................................................................................................................<.........................................................................................................>....................... .................................................................................
..................................................................................................................................................<..>............................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ...
.......................................................................................................................................................................................... .................................................................................................................................<.<...>>................................................................................................................................................................................................................................................................................................................................................... ..............
...................................................................................................................................................<......>................................. ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ............
............................................................................................................................ .................................................................................................................................<.<...>>...........................................................................................................................................................................................................<...............................................................................................................>....................... ............................................................................
..................... .................................................................................................................................<.<...>>............................................................................................................................................................................................................................................................................................................<...................................... .>.................................................................................................................................................................................
.........................<.<...>>.... ........................................................................................................................................<...............................................................................................................>................................................................................................................................................................................................................................... ...................................................................................................................................................................
................................... ..........................................................................................................................................................................................................................................................................................................................................................................<................................................................................................................. ........>............................................................................................................................................................
....................... ................................................................................................................................<.<....>>..........................................................................................................................................................................................................................................................................................................<........................................ ....>............................................................................................................................................................................
AL939123.1 0.00 .GAAUCCCCUGCCGGAGCUGGACGACAUCAUGCUGCUCACCUACGAACUGACGCUCUGACACGGCCGCGGCACACCGUCACGGCACCGCGCCGGGACACAACAUCUGGGGGUGCUCGCGUCCCCCGGCACAAGAUGU AUGCUCAUGCUCG.CUGUCGCC..-------...........GCA-...........---------...---G.GGGAAU.CCGGUGC............................GAAU.CCGGAACUGU-CCCGCAACGGUGU.AC--..................................................----UUGCGUGCAUCC-.........................----GUACGUcu..............UCGC...............................................................ACGUGCG--.---.cGCA..CGCCU--------...................................................................--GU.cCAGUCCGAGGACCUGCCGACAGUGCGCCCGGCCGCCCUGGCCCGGGUGCCAUGACGUCCGGGCCUCGCGGAGUGGGCCGGUGGACGCGACGCCGCGUGC
........................................................................................................................................ ........................................................................................................................................<..........................................................................................................................................................................................................>........................................................................................................................................ ................................................................
..................................................................................................................................<......>................................... ......................................................................................<....................................................................................................................>................................................................................................................................................................................................................................................................................ ...........................
............................. ................................................................................................................................<.<....>>................................................................................................................................................................................................................................................................................................................................................... ...........................................................................................................................................................................
........................................................................... ................................................................................................................................<.<....>>................................................................................................................................................................................................................................................................................................................................................... .............................................................................................................................
..............................................................................................................................................<.<...>>............................................. ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ .....
..................................................................................................................................................................................... .................................................................................................................................<.<...>>...........................................................................................................................................................................................................<...............................................................................................................>....................... ...................
.................................................... .................................................................................................................................<.<...>>.................................................................................................................................................................................................................<.........................................................................................................>....................... ....................................................................................................................................................
.................................................................................................................. .................................................................................................................................<.<...>>...........................................................................................................................................................................................................<...............................................................................................................>....................... ......................................................................................
..............................................................................................................................................<..>.............................................. ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ........
............................................................................... .................................................................................................................................<.<...>>...........................................................................................................................................................................................................<...............................................................................................................>....................... .........................................................................................................................
........................................................ ................................................................................................................................<.<....>>..................................................................................................................................................................................................................................<...............................................................................................................> ................................................................................................................................................
..... ..............................................................................................................................................................................................................................................................................................................................................................<......>...................................................................................................................... ...................................................................................................................................................................................................
............................................................................................................ ..............................................................<........>.................................................................................................................................................................................................................................................................................................................................................................................................................... ............................................................................................
.............................. .................................................................................................................................<.<...>>...........................................................................................................................................................................................................<...............................................................................................................>....................... ..........................................................................................................................................................................
................................................................................... .................................................................................................................................<.<...>>...........................................................................................................................................................................................................<...............................................................................................................>....................... .....................................................................................................................
........... .................................................................................................................................................................................................................................................................................................................................................<...>...................................................................................................................................... .............................................................................................................................................................................................
................................ ..............................................................................................................................................................................................................<...>......................................................................................................................................................................................................................................................................... ........................................................................................................................................................................
........................................ .................................................................................................................................<.<...>>...........................................................................................................................................................................................................<...............................................................................................................>....................... .....................................................................................................................................................
................................................................................................................................. .................................................................................................................................<.<...>>................................................................................................................................................................................................................................................................................................................................................... .......................................................................
Z99120.2 0.00 .GAGGAUUUUGCUUCCAUACACAAUAUGGGGAAAAGUCAUUCAGGACACAUAUACAAGCCUGUCAGUCAUAUAGUAUAAUUACUCCGAAAAAC GGAUACGAAUGUC.AAAUAGGU..GCCGGUCc..........GUGAacaac......AGCCGGCUU...AAAA.GGGAAA.CCGGUA-............................AAAG.CCGGUGCGGU-CCCGCCACUGUAA.UUG-..................................................-----------------.........................GC--------................-CAA...............................................................---------gCGC..---..-------------...................................................................-CAA..GAGCCAGGAUACCUGCCUGUUUGAUCAGCACGAAUUCUGCGAGGACAGAUGAUGUGUAAACAAUAGGCUUUUUUGUGUUGUUUACAGCAUCUUUACCGUCGUAGAGAUGCUUUUUUAGUUCGUUUAGGAGGAAAAGAUUAUGA
....................................................................<...>................... ...................................................................................<.........................................................................................................................................................................................................................................................................................................................................................................>.............................. ............................................................................................................