Seq ID Score (bits) Sequence
...................................................................................................................................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ..................................
................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ .....................................................................................................................................................................................
.................................................. ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ......................................................................................................................................................
.................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ....................................................................................................................................................................................
................................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ .....................................................................................................................................
.............................................................................. ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ..........................................................................................................................
.................................................................................................................................. ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ......................................................................
.............................................................................. ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ..........................................................................................................................
......................................................................................................................................................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ...............
............................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ .........................................................................................................................................................................
.................................................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ....................................................................................................................
.................................................................................................................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ....................................................
..................................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ...................................................................................................................................
...................................................................................................................................................................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ..
.......................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ..............................................................................................................................................................................
AE009314.1 0.00 .UGACAUUCCGGUGAUAGAUGCCUUGACCAGUUCAACGACAUGCG ACAUUGGUUAGCC.AUCGUGGUu.CUGCGGAc..........GAAGg..........UCCGGAGCU...AAGA.GGGAAU.UCGGUGAgggcuuuaaucacagccu..........GAAU.CCGAAGCUGCCCCCGCAACUGUAA.GCGAc.................................................GAGCGAAAGUCCAUCAU.........................GUCACUGAGG................CCGG...............................................................CCUCGGGAA.GAC..GGA..CCAAAGCUAUGAC...................................................................CCGC..AAGCCAGGAGACCUGCCGCGAUAGAUAACGUCCACGGGCGGGGUGUCCCGGAGUGCCGCUUUCGCGAUAGGUAUUCCCGUGCCUUUG
............................................ ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ....................................................
........................................................................ ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ................................................................................................................................
..................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ...................................................................................................................................................................................
.................................................................................................................................................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ....................
........................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ .............................................................................................................................................
............................................................................................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ .........................................................................
........................................................................................................................................ ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ................................................................
AE013011.1 0.00 .AAAGUAAGAGUUAAAAUGAAAUUAAAACU GAAUAUAAAAAGC.CUUAUGGU..CCC----...........GUGAu..........----GGGUU...AAAA.GGGAAGaCGGGUGA............................GAAU.CCCGCGCAGCCCCCGCUACUGUGA.GGGA..................................................GGACGAAGCCCUAGUAA.........................GCCACUGUCCggcac...........UCAA........cugagcgcguuaguaaggagaaaagagggagagaaauugcguucaguugagugccGGAUGGGAA.GGC..AGG..GUGGAGGAUGAG-...................................................................UCCC..GAGCCAGGAGACCUGCCAUAAGGUUUUUAAAAGUUCGCCUUCGGAGGGAAGGUUGAACG
............................. ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ........................
.............................................................................................................. ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ..........................................................................................
...................................................................................................................................................................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ..
............................................. ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ...........................................................................................................................................................
......................................................................................................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ...............................................................
........................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ...........................................................
................................................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ .....................................................................................................................
...................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ..................................................................................................................................................................
......................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ...............................................................................................................................................................
............................................................................ ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ............................................................................................................................
......................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ...............................................................................................................................................................................
............................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ .........................................................................................................................................
................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ .....................................................................................................................................................................................
............ ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ............................................................................................................................................................................................
.................................................................................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ....................................................................................
............................................................................................................. ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ...........................................................................................
.......................................................................................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ..............................................................................
........................ ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ................................................................................................................................................................................
.................................................................................................................................................................................. ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ......................
............................................................................................................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ .........................................................
....................................................................................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ .................................................................................
..................................................................................................................................................................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ...
.......................................................................................................................................................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ..............
............................................................................................................................................................................................ ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ............
............................................................................................................................ ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ............................................................................
..................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ...................................................................................................................................................................................
..................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ...................................................................................................................................................................
................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ .....................................................................................................................................................................
....................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ .................................................................................................................................................................................
AL939123.1 0.00 .GAAUCCCCUGCCGGAGCUGGACGACAUCAUGCUGCUCACCUACGAACUGACGCUCUGACACGGCCGCGGCACACCGUCACGGCACCGCGCCGGGACACAACAUCUGGGGGUGCUCGCGUCCCCCGGCACAAGAUGU AUGCUCAUGCUCG.CUGUCGCC..-------...........GCA-...........---------...---G.GGGAAU.CCGGUGC............................GAAU.CCGGAACUGU-CCCGCAACGGUGU.AC--..................................................----UUGCGUGCAUCC-.........................----GUACGUcu..............UCGC...............................................................ACGUGCG--.---.cGCA..CGCCU--------...................................................................--GU.cCAGUCCGAGGACCUGCCGACAGUGCGCCCGGCCGCCCUGGCCCGGGUGCCAUGACGUCCGGGCCUCGCGGAGUGGGCCGGUGGACGCGACGCCGCGUGC
........................................................................................................................................ ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ................................................................
............................................................................................................................................................................. ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ...........................
............................. ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ...........................................................................................................................................................................
........................................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ .............................................................................................................................
................................................................................................................................................................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ .....
..................................................................................................................................................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ...................
.................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ....................................................................................................................................................
.................................................................................................................. ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ......................................................................................
................................................................................................................................................................................................ ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ........
............................................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ .........................................................................................................................
........................................................ ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ................................................................................................................................................
..... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ...................................................................................................................................................................................................
............................................................................................................ ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ............................................................................................
.............................. ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ..........................................................................................................................................................................
................................................................................... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ .....................................................................................................................
........... ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ .............................................................................................................................................................................................
................................ ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ........................................................................................................................................................................
........................................ ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ .....................................................................................................................................................
................................................................................................................................. ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ .......................................................................
Z99120.2 0.00 .GAGGAUUUUGCUUCCAUACACAAUAUGGGGAAAAGUCAUUCAGGACACAUAUACAAGCCUGUCAGUCAUAUAGUAUAAUUACUCCGAAAAAC GGAUACGAAUGUC.AAAUAGGU..GCCGGUCc..........GUGAacaac......AGCCGGCUU...AAAA.GGGAAA.CCGGUA-............................AAAG.CCGGUGCGGU-CCCGCCACUGUAA.UUG-..................................................-----------------.........................GC--------................-CAA...............................................................---------gCGC..---..-------------...................................................................-CAA..GAGCCAGGAUACCUGCCUGUUUGAUCAGCACGAAUUCUGCGAGGACAGAUGAUGUGUAAACAAUAGGCUUUUUUGUGUUGUUUACAGCAUCUUUACCGUCGUAGAGAUGCUUUUUUAGUUCGUUUAGGAGGAAAAGAUUAUGA
............................................................................................ ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ ............................................................................................................